diff --git a/String Algorithms/Two-Way String-Matching Algorithm/Program.c b/String Algorithms/Two-Way String-Matching Algorithm/Program.c
new file mode 100644
index 00000000..a0d80be6
--- /dev/null
+++ b/String Algorithms/Two-Way String-Matching Algorithm/Program.c	
@@ -0,0 +1,112 @@
+#include <stdio.h>
+#include <string.h>
+#include <stdlib.h>
+
+#define MAX_PATTERN_LENGTH 1000
+
+// Function to compute the critical factorization point
+int computeCriticalPoint(const char* pattern, int length) {
+    int i = 1, j = 0;
+    int period = 1;
+    
+    while (i + j < length) {
+        if (pattern[i + j] == pattern[j]) {
+            j++;
+        } else if (pattern[i + j] > pattern[j]) {
+            j = 0;
+            i += period;
+            period = 1;
+        } else {
+            j = 0;
+            i++;
+            period = i;
+        }
+    }
+    
+    return i;
+}
+
+// Function to compute the pattern period
+int computePeriod(const char* pattern, int length) {
+    int period = 1;
+    while (period <= length / 2) {
+        int isValid = 1;
+        for (int i = period; i < length; i++) {
+            if (pattern[i] != pattern[i - period]) {
+                isValid = 0;
+                break;
+            }
+        }
+        if (isValid) {
+            return period;
+        }
+        period++;
+    }
+    return length;
+}
+
+// Function to perform backward matching
+int backwardMatch(const char* text, const char* pattern, int start, int length) {
+    int i = length - 1;
+    while (i >= 0 && text[start + i] == pattern[i]) {
+        i--;
+    }
+    return i;
+}
+
+// Main Two-Way String-Matching algorithm
+void twoWayMatching(const char* text, int textLength, const char* pattern, int patternLength) {
+    if (patternLength == 0) {
+        printf("Pattern is empty\n");
+        return;
+    }
+    
+    // Compute critical factorization point
+    int criticalPoint = computeCriticalPoint(pattern, patternLength);
+    
+    // Compute pattern period
+    int period = computePeriod(pattern, patternLength);
+    
+    // Main search loop
+    int pos = 0;
+    while (pos <= textLength - patternLength) {
+        // Forward scan until critical point
+        int i = 0;
+        while (i < criticalPoint && pattern[i] == text[pos + i]) {
+            i++;
+        }
+        
+        if (i == criticalPoint) {
+            // Backward scan from the end
+            int j = backwardMatch(text, pattern, pos, patternLength);
+            
+            if (j < 0) {
+                // Pattern found
+                printf("Pattern found at index %d\n", pos);
+                pos += period;
+            } else {
+                // Mismatch in backward scan
+                pos += j + 1;
+            }
+        } else {
+            // Mismatch in forward scan
+            pos += i + 1;
+        }
+    }
+}
+
+int main() {
+    const char* text = "GCATCGCAGAGAGTATACAGTACG";
+    const char* pattern = "GCAGAGAG";
+
+    int textLength = strlen(text);
+    int patternLength = strlen(pattern);
+
+    printf("Text: %s\n", text);
+    printf("Pattern: %s\n", pattern);
+    printf("Matches:\n");
+
+    twoWayMatching(text, textLength, pattern, patternLength);
+
+    return 0;
+}
\ No newline at end of file
diff --git a/String Algorithms/Two-Way String-Matching Algorithm/README.md b/String Algorithms/Two-Way String-Matching Algorithm/README.md
new file mode 100644
index 00000000..d187f4c7
--- /dev/null
+++ b/String Algorithms/Two-Way String-Matching Algorithm/README.md	
@@ -0,0 +1,80 @@
+# Two-Way String-Matching Algorithm
+
+## Description
+
+The Two-Way String-Matching algorithm, developed by Crochemore and Perrin in 1991, is an efficient pattern matching algorithm that improves upon the Boyer-Moore algorithm by scanning the pattern in both directions. It combines forward and backward pattern scanning to achieve optimal searching in linear time.
+
+### Problem Definition
+
+Given:
+- A pattern string P of length m
+- A text string T of length n
+
+Objective:
+- Find all occurrences of P in T
+
+### Algorithm Overview
+
+1. **Pattern Analysis**:
+   - Factorize the pattern into two parts
+   - Compute the critical factorization point
+   - Analyze pattern periodicity
+
+2. **Searching Phase**:
+   - Perform forward scan until a mismatch or potential match
+   - For potential matches, perform backward scan
+   - Use period information to make maximal shifts
+
+### Key Features
+
+- Combines advantages of Boyer-Moore and Knuth-Morris-Pratt algorithms
+- Uses bidirectional pattern scanning
+- Achieves optimal worst-case complexity
+- Performs well on both short and long patterns
+- Particularly efficient for patterns with low periodicity
+
+### Time Complexity
+
+- Preprocessing: O(m), where m is the length of the pattern
+- Searching: O(n), where n is the length of the text
+- Total: O(n + m)
+- In practice, achieves sublinear time on many inputs
+
+### Space Complexity
+
+O(m), where m is the length of the pattern
+
+## Implementation
+
+The implementation in C demonstrates the Two-Way String-Matching algorithm for exact string matching. It includes:
+
+1. Functions to analyze the pattern and find its critical factorization
+2. The main two-way search algorithm
+3. Helper functions for period computation
+4. A demonstration of the algorithm's usage
+
+## Usage
+
+Compile the program and run it. The example in the main function demonstrates how to use the Two-Way String-Matching algorithm to find all occurrences of a pattern in a given text.
+
+## Advantages
+
+- Better average-case performance compared to classic algorithms
+- Optimal worst-case complexity
+- No preprocessing of the text required
+- Efficient handling of patterns with non-trivial periods
+- Suitable for both short and long patterns
+
+## Limitations
+
+- More complex implementation compared to simpler algorithms
+- Preprocessing phase requires careful handling of pattern periodicity
+- Memory usage proportional to pattern length
+
+## Applications
+
+- Text editors and word processors
+- Bioinformatics sequence matching
+- Network packet inspection
+- Data compression algorithms
+- Digital forensics
\ No newline at end of file