From 39c6aac72bcead9578c8c0eaf03dec5bfc4a0f29 Mon Sep 17 00:00:00 2001 From: Elizabeth Kiernan <55763654+ekiernan@users.noreply.github.com> Date: Tue, 3 Dec 2024 09:08:51 -0500 Subject: [PATCH] PD-2803: Fixing Optimus h5ad generation to handle gene_ids more flexibly (#1431) Updated docker for h5ad creation in Optimus allowing for more flexible gene_id handling --- pipeline_versions.txt | 8 ++++---- pipelines/skylab/atac/atac.changelog.md | 5 +++++ pipelines/skylab/atac/atac.wdl | 4 ++-- pipelines/skylab/multiome/Multiome.changelog.md | 3 ++- pipelines/skylab/optimus/Optimus.changelog.md | 3 ++- pipelines/skylab/optimus/Optimus.wdl | 2 +- pipelines/skylab/paired_tag/PairedTag.changelog.md | 3 ++- pipelines/skylab/slideseq/SlideSeq.changelog.md | 1 + pipelines/skylab/slideseq/SlideSeq.wdl | 2 +- tasks/skylab/FastqProcessing.wdl | 2 +- 10 files changed, 21 insertions(+), 12 deletions(-) diff --git a/pipeline_versions.txt b/pipeline_versions.txt index 9964940111..d06921a88f 100644 --- a/pipeline_versions.txt +++ b/pipeline_versions.txt @@ -30,11 +30,11 @@ ExomeReprocessing 3.3.3 2024-11-04 BuildIndices 3.0.0 2023-12-06 scATAC 1.3.2 2023-08-03 snm3C 4.0.4 2024-08-06 -Multiome 5.9.2 2024-11-15 -PairedTag 1.8.3 2024-11-15 +Multiome 5.9.2 2024-11-22 +PairedTag 1.8.3 2024-11-22 MultiSampleSmartSeq2 2.2.22 2024-09-11 MultiSampleSmartSeq2SingleNucleus 2.0.5 2024-11-15 -Optimus 7.8.3 2024-11-15 -atac 2.5.2 2024-11-12 +Optimus 7.8.3 2024-11-22 +atac 2.5.3 2024-11-22 SmartSeq2SingleSample 5.1.21 2024-09-11 SlideSeq 3.4.6 2024-11-15 diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md index 5c2c0aea4b..578088a0d6 100644 --- a/pipelines/skylab/atac/atac.changelog.md +++ b/pipelines/skylab/atac/atac.changelog.md @@ -1,3 +1,8 @@ +# 2.5.3 +2024-11-22 (Date of Last Commit) + +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files; does not impact ATAC workflow + # 2.5.2 2024-11-12 (Date of Last Commit) diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl index 521cb09dfd..c0c748c042 100644 --- a/pipelines/skylab/atac/atac.wdl +++ b/pipelines/skylab/atac/atac.wdl @@ -49,7 +49,7 @@ workflow ATAC { String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG" } - String pipeline_version = "2.5.2" + String pipeline_version = "2.5.3" # Determine docker prefix based on cloud provider String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/" @@ -57,7 +57,7 @@ workflow ATAC { String docker_prefix = if cloud_provider == "gcp" then gcr_docker_prefix else acr_docker_prefix # Docker image names - String warp_tools_2_2_0 = "warp-tools:2.2.0" + String warp_tools_2_2_0 = "warp-tools:2.5.0" String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919" String samtools_docker = "samtools-dist-bwa:3.0.0" String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311" diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md index 4a05f926be..b1577ed4be 100644 --- a/pipelines/skylab/multiome/Multiome.changelog.md +++ b/pipelines/skylab/multiome/Multiome.changelog.md @@ -1,7 +1,8 @@ # 5.9.2 -2024-11-15 (Date of Last Commit) +2024-11-22 (Date of Last Commit) * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files # 5.9.1 2024-11-12 (Date of Last Commit) diff --git a/pipelines/skylab/optimus/Optimus.changelog.md b/pipelines/skylab/optimus/Optimus.changelog.md index d05e53bee5..9e7e385c8a 100644 --- a/pipelines/skylab/optimus/Optimus.changelog.md +++ b/pipelines/skylab/optimus/Optimus.changelog.md @@ -1,7 +1,8 @@ # 7.8.3 -2024-11-15 (Date of Last Commit) +2024-11-22 (Date of Last Commit) * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files # 7.8.2 2024-11-12 (Date of Last Commit) diff --git a/pipelines/skylab/optimus/Optimus.wdl b/pipelines/skylab/optimus/Optimus.wdl index 41a71d3cb6..fc027f0ee0 100644 --- a/pipelines/skylab/optimus/Optimus.wdl +++ b/pipelines/skylab/optimus/Optimus.wdl @@ -91,7 +91,7 @@ workflow Optimus { String pytools_docker = "pytools:1.0.0-1661263730" String empty_drops_docker = "empty-drops:1.0.1-4.2" String star_docker = "star:1.0.1-2.7.11a-1692706072" - String warp_tools_docker_2_2_0 = "warp-tools:2.4.0" + String warp_tools_docker_2_2_0 = "warp-tools:2.5.0" String star_merge_docker = "star-merge-npz:1.3.0" String samtools_star = "samtools-star:1.0.0-1.11-2.7.11a-1731516196" diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md index e411e0f679..3ada0c9188 100644 --- a/pipelines/skylab/paired_tag/PairedTag.changelog.md +++ b/pipelines/skylab/paired_tag/PairedTag.changelog.md @@ -1,7 +1,8 @@ # 1.8.3 -2024-11-15 (Date of Last Commit) +2024-11-22 (Date of Last Commit) * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files # 1.8.2 2024-11-12 (Date of Last Commit) diff --git a/pipelines/skylab/slideseq/SlideSeq.changelog.md b/pipelines/skylab/slideseq/SlideSeq.changelog.md index 54c9fb6890..a40017660d 100644 --- a/pipelines/skylab/slideseq/SlideSeq.changelog.md +++ b/pipelines/skylab/slideseq/SlideSeq.changelog.md @@ -2,6 +2,7 @@ 2024-11-15 (Date of Last Commit) * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files # 3.4.5 2024-11-12 (Date of Last Commit) diff --git a/pipelines/skylab/slideseq/SlideSeq.wdl b/pipelines/skylab/slideseq/SlideSeq.wdl index 7c69d79232..e258436f8a 100644 --- a/pipelines/skylab/slideseq/SlideSeq.wdl +++ b/pipelines/skylab/slideseq/SlideSeq.wdl @@ -48,7 +48,7 @@ workflow SlideSeq { # docker images String pytools_docker = "pytools:1.0.0-1661263730" String picard_cloud_docker = "picard-cloud:2.26.10" - String warp_tools_docker_2_2_0 = "warp-tools:2.4.0" + String warp_tools_docker_2_2_0 = "warp-tools:2.5.0" String star_merge_docker = "star-merge-npz:1.3.0" String ubuntu_docker = "ubuntu_16_0_4@sha256:025124e2f1cf4d29149958f17270596bffe13fc6acca6252977c572dd5ba01bf" diff --git a/tasks/skylab/FastqProcessing.wdl b/tasks/skylab/FastqProcessing.wdl index ea7363b738..5263f53ef2 100644 --- a/tasks/skylab/FastqProcessing.wdl +++ b/tasks/skylab/FastqProcessing.wdl @@ -138,7 +138,7 @@ task FastqProcessingSlidSeq { # Runtime attributes - String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0" + String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.5.0" Int cpu = 16 Int machine_mb = 40000 Int disk = ceil(size(r1_fastq, "GiB")*3 + size(r2_fastq, "GiB")*3) + 50