You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
Are multiple variants allowed for the same reported isomiR sequence?
For example, isomiR Sequence TGGGGCGGAGCTTCCGGAGGC has the following possible locations just within miRBase22.
MIMAT0015058_2&hsa-miR-3180-3p&offsets|0|-1
MIMAT0018178_1&hsa-miR-3180&offsets|0|+2
MIMAT0015058_1&hsa-miR-3180-3p&offsets|0|-1
MIMAT0015058&hsa-miR-3180-3p&offsets|0|-1
If so, what would the recommendation of the above be? Should folks generating the GFF3 file be encouraged to report all four (including the 0|-1 and 0|+2 offsets) above within Column 9->Attributes->variant?
The text was updated successfully, but these errors were encountered:
Are multiple variants allowed for the same reported isomiR sequence?
For example, isomiR Sequence TGGGGCGGAGCTTCCGGAGGC has the following possible locations just within miRBase22.
MIMAT0015058_2&hsa-miR-3180-3p&offsets|0|-1
MIMAT0018178_1&hsa-miR-3180&offsets|0|+2
MIMAT0015058_1&hsa-miR-3180-3p&offsets|0|-1
MIMAT0015058&hsa-miR-3180-3p&offsets|0|-1
If so, what would the recommendation of the above be? Should folks generating the GFF3 file be encouraged to report all four (including the 0|-1 and 0|+2 offsets) above within Column 9->Attributes->variant?
The text was updated successfully, but these errors were encountered: