Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

VSEARCH error on amptk -filter step #105

Open
MelissaIngala opened this issue Feb 16, 2024 · 0 comments
Open

VSEARCH error on amptk -filter step #105

MelissaIngala opened this issue Feb 16, 2024 · 0 comments

Comments

@MelissaIngala
Copy link

Hello,

I am using amptk to analyze some paired-end COI diet data from bat feces. I have mostly gotten the pipeline to work, except for the amptk -filter step. My dataset included 2 mock communities, which I think amptk cannot handle, so i set my mock equal to IM3a and asked it to ignore IM3b. When I run the below command, I get the following error in the log file:

amptk filter -i cluster.otu_table.txt -f cluster.cluster.otus.fa -b IM3a -m mock_members_seqs.fas --ignore IM3b

Reading file cluster.otus.counts.fa

Fatal error: Invalid (zero) abundance annotation in FASTA file header

However, when I inspect the cluster.otus.counts.fa file, it appears to contain the abundance annotation:

>OTU1;size=1272388
AACATTATATTTTATTTTTGGTGTGTGATCCGGTATAGTAGGAACCTCTTTAAGTCTTTTAATCCGAGCCGAATTAGGCCACCCAGGTTCTCTAATTGGAGACGATCAAATTTATAATGTTATTGTAACTGCCCACGCCTTCATCATAATCTTCTTTATAGTAATGCCAATTATAATTGGAGGATTTGGAAATTGATTAGTACC
>OTU2;size=91828
AACTTTATATTTTATTTTTGGGGCTTGAGCAGGAATAATCGGAACTTCCCTAAGAATATTAATTCGAGCAGAACTAAGTCATGCCGGATCTTTAATTGGAAACGACCAAATTTATAATGTTATTGTTACTGCTCATGCATTTATTATAAttttttttATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACC
>OTU9;size=55353

Any idea what might be causing this error? Thanks so much!

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

1 participant