Skip to content

Latest commit

 

History

History

test

Folders and files

NameName
Last commit message
Last commit date

parent directory

..
 
 

Test

We provide following examples:

  • precomputed: aligned BAM files with mv table (and optionally precomputed transcript ends and read-transcript table)
  • raw reads: pod5 files, reference genome FastA and GTF

Precomputed

We provide precomputed datasets for:

  • DNA standards - synthetic cDNA oligos complementary to RNA strand terminated with
    • *A: A-only tail with varying lengths (0, 15, 30, 60, 90 or 120);
    • *U, 5G, 5C: 30 bases long poly-A tail that ends by either Us (1, 3 or 5), Gs (5) or Cs (5);
    • IntG: 15 As followed by 3 GAAAA repeats
  • Yeast total RNA sequenced with R9 (old N3PS oligo) and R10 (new N3PS oligo) chemistry

Above data is already basecalled and aligned, so you'll perform only the last step of polyTailor.

DNA standards

Note, DNA standards were sequenced using old N3Pseq oligo CAGCACCT CTTCCGATCACTTGCCTGTCGCTCTATCTTC.

We prefiltered only the reads for which the alignment starts in expected reference posittion (+/-1). For example, for 0A, 60A and 120A, the alignments should start at position 1, 61 and 121 of the reference, respectively (adding 12 bases that are typically lost from 5'-end by ONT sequencing).

First download the data

cd ~/src/polyTailor/test
wget https://public-docs.crg.es/enovoa/public/lpryszcz/src/polyTailor/test/{ref,minimap2} -q --show-progress -r -c -nc -np -nH --cut-dirs=6 --reject="index.html*"

Then process all aligned reads with polyTailor:

cd test
for f in minimap2/DNA_standards/*.bam; do
  echo $f;
  python ../src/get_pt.py -b $f -o $f.pT.tsv.gz \
    -p CAGCACCTCTTCCGATCACTTGCCTGTCGCTCTATCTTC;
done

for f in minimap2/DNA_standards/*.bam.pT.tsv.gz; do echo $f; zcat $f|head; done

This will produce an output file for each BAM file similar to these:

  • minimap2/DNA_standards/30A.bam.pT.tsv.gz: 30 bases long poly-A tails
read_id	barcode	mapq	filter	pt_length	per_base	primer_end	pt_start	before_pt	pt_seq	transcript_end	distance	comment
a5befef8-9780-4d0a-88f8-27941bb13c5d	unknown	60	OK	26.3	2.2	108	108	CTCTATCTTC	TTTTTTTTTTTTTTTTTTTTTTTTTTTT
3b41842a-fbb4-4c84-bde7-e3c1adb645c3	unknown	60	OK	22.7	2.4	106	106	CTCTATCTTC	TTTTTTTTTTTTTTTTTTTTTTTTTTT
8632b9b8-0c4d-4f3c-82e3-8142704869c4	unknown	60	OK	22.3	1.9	80	80	CTCTATCTTC	TTTTTTTTTTTTTTTTTTTTTTTT
7a5748d3-c905-48fe-8b16-8c886c7c5bfc	unknown	60	OK	39.5	2.0	103	103	CTCTATCTTC	TTTTTTT
b5f88ac9-924d-4d64-bdba-234c6ac03a7d	unknown	60	not_complete	23.1	2.2	100	99	ACTCTGTCTT	TTTTTTTTTTTTTTTTTTTTTTTT
b016d2c7-bf3c-4352-bc9c-a1ceeb05dc4b	unknown	60	no_primer	0	0.0	0	0
25056f68-1672-4476-9aa3-da3d36571150	unknown	60	not_continuous	33.4	2.0	105	106	TCTATTACTC	TTT
5fa7b265-720f-4baa-9c5f-c0aff976e89f	unknown	60	not_continuous	26.7	2.0	111	112	TCTATCTTTC	TTTTTTTTTTTTTTTTTT
80a1a47e-a6f8-41dd-810c-ffc4e8382ed7	unknown	60	OK	18.9	2.3	99	99	CTCTATCTTC	TTTTTTTTTTTTTTTTTTTTTTT
  • minimap2/DNA_standards/3U.bam.pT.tsv.gz: 27 bases long poly-A tails with 3 terminal U bases -UUU
read_id	barcode	mapq	filter	pt_length	per_base	primer_end	pt_start	before_pt	pt_seq	transcript_end	distance	comment
141fd2e1-5e6a-4563-8ae8-cdc7ba970420	unknown	60	no_primer	0	0.0	0	0
e6c7cbb2-e3b0-42e3-81d2-232c3095c247	unknown	60	not_continuous	12.3	2.5	100	103	TATCTTCAAA	TTTTTTTTTTTTTTTTTTT
6fce380f-d07f-43c9-bbd4-4388b2ebbefb	unknown	60	not_continuous	17.0	2.0	103	106	ATCTCTCAAA	TTTTTTTTTTTTTTTTTTTTT
1d19cf3b-6dd7-466b-acb4-098217dbb7db	unknown	60	not_continuous	31.1	2.7	102	105	TATCTTCAAA	TTTTTTTTTTTTTTTTTTTTTTT
e35251ce-8eff-4404-8229-5c51d12a805d	unknown	60	not_continuous	12.6	2.6	103	106	TATCTTCAAA	TTTTTTTTTTTTTTTTTTTTT
b905967e-b1b8-4f3f-a8b9-618019281d0c	unknown	60	not_continuous	23.5	2.0	106	109	TATCTTCAAA	TTTTTTTTTTTTTTTTTTTTTT
4c1cf405-f654-424b-81bc-f49d53771a07	unknown	60	not_continuous	27.9	2.5	93	96	TATCTTCAAA	TTTTTTTTT
a5fceb81-fdb7-4940-b65c-e6ca470b7b7c	unknown	60	not_continuous	25.4	1.7	111	114	TATCTTCAAA	TTTTTTTTTTTTTTTTTTTTTT
61e1a025-cbe1-47bc-b914-3e245cbed9a6	unknown	60	not_continuous	31.3	2.2	105	108	TATCTTCAAA	TTTTTTTTTTTTTTTTTTTTT
  • minimap2/DNA_standards/IntG.bam.pT.tsv.gz: 15 As followed by 3 GAAAA repeats
read_id	barcode	mapq	filter	pt_length	per_base	primer_end	pt_start	before_pt	pt_seq	transcript_end	distance	comment
c8dac82d-84ab-4e20-8009-2167b7e3e663	unknown	60	OK	18.9	2.1	103	103	CTCTATCTTC	TTTTCTTTTCTTTTCTTTTTTTT
ca553d91-932f-4d38-904a-30032dac1a41	unknown	60	OK	17.8	2.8	98	98	CGCTATTTTC	TTTCTTTCTTTCTTTTTTTTT
c25281bc-cca0-457c-aa6d-7a549225aa77	unknown	60	OK	21.1	2.6	103	103	CTCTATCTTC	TTTTCTTTTCTTTTCTTTTTTTTTTTTTTTT
f0a8d4b0-c6c2-447f-a828-d9d094bc50c4	unknown	60	OK	22.5	2.2	103	103	CTCTATCTTC	TTTTCTTTTCTTTTCTTTTTTTTTTTTT
f5463600-ff47-45fc-a383-1dea01ebb638	unknown	60	OK	38.3	1.9	108	108	TATTATCTTC	TTTTCTTTTCTTTCTTTTTTTTTTTTTTTT
9ea3e226-c471-462f-b778-6c68d48d02b1	unknown	60	OK	28.5	2.1	99	99	CTCTATCTTC	TTTTCTTTTCTTTTCTTTTTTTTTTTTTTTT
6b5ed755-3d08-4b2d-b657-6eeb442d00fc	unknown	60	OK	17.8	2.4	103	103	CTCTATCTTC	TTTTCTTTTCTTTTCTTTTTTTTTTTTTTT
0274dc63-22a2-4da9-b4c9-7ceeff7761ff	unknown	60	OK	30.1	2.0	108	108	CTCTATCTTC	TTTTCTTTTCTTTTCTTTTTTTTTTTT
4fb0624c-4fa2-4660-b9ab-62409bf7b522	unknown	10	no_clip	0	0.0	0	0

Additional figures can be generated using /notebook/DNA_standards.ipynb

DNA standards: length DNA standards: composition

Yeast total RNA

Here, new N3PS oligo CAGCACCT ACTTGCCTGTCGCTCTATCTGCAGAGCAGAG was used, therefore we don't need to change -p.

  • yeast total RNA
read_id	barcode	mapq	filter	pt_length	per_base	pt_start	before_pt	pt_seq	transcript_end	distance	comment
7d7576b3-3872-4c22-baf0-620f35f0917f	unknown	7	OK	57.8	2.1	105	CCAGAGCAAG	TTTT
11cdb20c-1808-4a5d-a6c6-7850daafb4b8	unknown	60	OK	36.3	2.5	100	CAGAGCAGAG	TTTTTTTTTTTTTTTTTT	GDH3|1|protein_coding	17
dc61cb45-7fa1-4c09-af85-21ce91e28879	unknown	60	OK	35.6	3.5	106	CAGAGCAGAG	TTTTTTTTTTTTTTTTTTT	GDH3|1|protein_coding	18
19625470-110e-4315-8354-79fd7574aadd	unknown	0	no_pT	0	0.0	0	RDN25-1|2|rRNA	1	
5517395a-bc83-471c-8f03-867b46333fcc	unknown	0	no_pT	0	0.0	0	RDN25-1|2|rRNA	1	

Raw reads

We provide raw datasets for:

  • Yeast total RNA sequenced with R9 (old N3PS oligo) and R10 (new N3PS oligo) chemistry

Yeast total RNA

If you wish to repeat the full polyTailor analysis descibed in the manuscript, follow these steps:

  1. Download reference genome and raw reads in pod5 format
cd ~/src/polyTailor/test
wget https://public-docs.crg.es/enovoa/public/lpryszcz/src/polyTailor/test/{ref,reads} -q --show-progress -r -c -nc -np -nH --cut-dirs=6 --reject="index.html*"

If you have previous results in minimap2/yeast, either remove or rename this directory.

mv minimap2/yeast minimap2/yeast.old
  1. Basecall
  • R9 run (0.5h for hac vs 1.5h for sup)
cd ~/src/polyTailor/test
mkdir -p dorado/yeast
dorado basecaller \
  ~/src/dorado/models/[email protected] \
  reads/yeast/R9 -r \
  --kit-name EXP-NBD104 \
  --no-trim \
  --emit-moves  \
  -x cuda:all > dorado/yeast/R9.bam
  • R10 run (0.5h for hac vs 12h for sup)
dorado basecaller \ 
  ~/src/dorado/models/[email protected] \
  reads/yeast/R10 -r \
  --kit-name SQK-NBD114-24 \
  --no-trim \
  --emit-moves  \
  -x cuda:all > dorado/yeast/R10.bam
  1. Align
conda activate polyTailor
mkdir -p minimap2/yeast
for f in dorado/yeast/*.bam; do
  echo `date` $f; 
  samtools fastq -T mv,ts,BC $f \
  | minimap2 -y -ax splice:hq -G2k ref/yeast.fa.gz - \
  | samtools sort --write-index -o minimap2/yeast/$(basename $f);
done
  1. Transcript ends
../src/get_transcript_ends.py --firststrand -q 0 -e 1000 \
  -a ref/yeast.gtf.gz -b minimap2/yeast/*.bam \
  -o minimap2/yeast/transcript_ends.tsv.gz 
  1. Assign reads to transcripts
isoquant.py --complete_genedb --data_type nanopore --stranded reverse \
  -r ref/yeast.fa.gz -g ref/yeast.gtf.gz --bam minimap2/yeast/*.bam \
  -o isoquant
zgrep -v '^#' isoquant/OUT/OUT.read_assignments.tsv.gz \
  | cut -f1,4,6,9 | gzip > minimap2/yeast/read_assignments.tsv.gz
  1. Estimate transcript ends and composition
  • R9 (old N3PS oligo)
f=minimap2/yeast/R9.bam; 
../src/get_pT.py -o $f.pT.tsv.gz -b $f \
  -e minimap2/yeast/transcript_ends.flt.tsv.gz.bed \
  -i minimap2/yeast/read_assignments.tsv.gz \
  -p CAGCACCTCTTCCGATCACTTGCCTGTCGCTCTATCTTC
  • R10 (new N3PS oligo)
f=minimap2/yeast/R10.bam; 
../src/get_pT.py -o $f.pT.tsv.gz -b $f \
  -e minimap2/yeast/transcript_ends.flt.tsv.gz.bed \
  -i minimap2/yeast/read_assignments.tsv.gz