Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Script stuck in infinite loop when restriction sites are too close to the ends #1

Open
TownJasonP opened this issue Aug 22, 2019 · 1 comment
Open

Script stuck in infinite loop when restriction sites are too close to the ends #1

TownJasonP opened this issue Aug 22, 2019 · 1 comment
Labels
bug Something isn't working

Comments

@TownJasonP
Copy link
Member

Could get around this with an oligo annealing + PCR strategy.
@TownJasonP TownJasonP added the bug Something isn't working label Aug 22, 2019
@tlnagy tlnagy changed the title Fails when restriction sites are too close to the ends of the sequence of interest Script stuck in infinite loop when restriction sites are too close to the ends Jan 15, 2020
@tlnagy
Copy link
Member

tlnagy commented Jan 15, 2020

Just ran into this again. The following sequence causes an infinite loop:

ggcttctctgagaccgtggacctgatgctgaacctgcagtccaataaggagggctctgtggatctgaagaacgtgagcgccgtgcctaaggagaagaccacactgaaggacccatccaagccccctgccaaggcacaggtggtgggatggccacccgtgcggaactacagaaagaatatgatgacccagcagaagacaagctcc

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Assignees
No one assigned
Labels
bug Something isn't working
Projects
None yet
Milestone
No milestone
Development

No branches or pull requests
2 participants
@tlnagy @TownJasonP