-
Notifications
You must be signed in to change notification settings - Fork 3
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Upgraded major dependencies and corrected problems that arose from changes. Fixed typos and spelling in doc. Removed the deprecated React.createClass from the doc examples.
- Loading branch information
Showing
9 changed files
with
7,820 additions
and
113 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,20 +1,19 @@ | ||
var path = require('path'); | ||
|
||
module.exports = { | ||
type: 'react-component', | ||
npm: { | ||
esModules: true, | ||
umd: { | ||
global: 'ReactSequenceViewer', | ||
externals: { | ||
react: 'React' | ||
} | ||
} | ||
}, | ||
webpack: { | ||
compat: { | ||
enzyme: true | ||
} | ||
} | ||
type: 'react-component', | ||
karma: { | ||
testContext: 'tests.webpack.js', | ||
testFiles: '.test.js' | ||
}, | ||
npm: { | ||
esModules: true, | ||
umd: { | ||
global: 'ReactSequenceViewer', | ||
externals: { | ||
react: 'React' | ||
} | ||
} | ||
}, | ||
}; | ||
|
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,7 @@ | ||
import { configure } from 'enzyme' | ||
import Adapter from 'enzyme-adapter-react-16' | ||
|
||
configure({adapter: new Adapter()}) | ||
|
||
let context = require.context('./tests', true, /\.js$/) | ||
context.keys().forEach(context) |
This file was deleted.
Oops, something went wrong.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,37 @@ | ||
import React from 'react'; | ||
import expect, {spyOn, createSpy} from 'expect'; | ||
import { mount } from 'enzyme'; | ||
import jquery from 'jquery'; | ||
window.jQuery = jquery; | ||
|
||
import 'bootstrap/dist/css/bootstrap.min.css'; | ||
|
||
import Component from 'src/index'; | ||
|
||
describe('<Component />', () => { | ||
const sequence = 'ctcgatgctagtcgatgctagtcgtagcta'; | ||
|
||
let seqViewer = document.createElement('div'); | ||
seqViewer.id = 'test'; | ||
|
||
beforeEach(() => { | ||
document.body.appendChild(seqViewer); | ||
}); | ||
|
||
afterEach(() => { | ||
document.body.removeChild(seqViewer); | ||
}); | ||
|
||
it('calls componentDidMount', () => { | ||
const spy = spyOn(Component.prototype, 'componentDidMount'); | ||
const wrapper = mount(<Component id="test" sequence="cgtagtcgatca" />); | ||
expect(spy).toHaveBeenCalled(); | ||
}); | ||
|
||
it('checking required props', () => { | ||
const wrapper = mount(<Component id="test" sequence={sequence} />); | ||
expect(wrapper.props().sequence).toEqual(sequence); | ||
expect(wrapper.props().id).toEqual("test"); | ||
}); | ||
}); | ||
|
Oops, something went wrong.