A notebook that creates an example of an SBOL2 generic location using…

… pysbol2. This addresses #26

examples/sbol2/CreatingSBOL2Objects/GenericLocation.ipynb

@@ -0,0 +1,143 @@
+{
+ "cells": [
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "## Using `GenericLocation` to Define Regions on a Sequence\n",
+    "\n",
+    "In some cases, a region may not have well-defined boundaries, or the sequence might be incomplete. In such cases, we can use the `GenericLocation` class in SBOL to annotate regions where the precise start and end points are not required.\n",
+    "\n",
+    "This is especially useful in synthetic biology for:\n",
+    "- Annotating regions with unknown or non-linear sequences.\n",
+    "- Handling circular DNA or non-linear structures.\n",
+    "- Providing sequence annotations for partially designed components.\n",
+    "\n",
+    "In this example, we'll create a sequence and annotate it using `GenericLocation`, specifying two regions: one on the forward strand (`inline`) and another on the reverse strand (`reverse complement`)."
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 17,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "import sbol2\n",
+    "\n",
+    "# Create an SBOL document\n",
+    "doc = sbol2.Document()\n",
+    "\n",
+    "# Set a namespace for the document\n",
+    "sbol2.setHomespace('https://github.com/SynBioDex/SBOL-Notebooks')\n",
+    "\n",
+    "# Create a Sequence object with an arbitrary DNA sequence\n",
+    "sequence_elements = 'ATGCGTACGTAGCTAGTCTGATCGTAGCTAGTCGATGCA'\n",
+    "seq = sbol2.Sequence('example_sequence')\n",
+    "seq.elements = sequence_elements\n",
+    "seq.encoding = sbol2.SBOL_ENCODING_IUPAC\n",
+    "\n",
+    "# Add the sequence to the document\n",
+    "doc.addSequence(seq)\n",
+    "\n",
+    "# Create a ComponentDefinition for the sequence\n",
+    "comp_def = sbol2.ComponentDefinition('example_component', sbol2.BIOPAX_DNA)\n",
+    "comp_def.sequences = [seq.identity]  # Link the sequence to the ComponentDefinition\n",
+    "\n",
+    "# Add the ComponentDefinition to the document\n",
+    "doc.addComponentDefinition(comp_def)\n",
+    "\n",
+    "# --- GenericLocation 1: Forward Strand (SBOL_ORIENTATION_INLINE) with sequence reference ---\n",
+    "# Create a SequenceAnnotation for a region on the forward strand\n",
+    "forward_annotation = sbol2.SequenceAnnotation('forward_region_annotation')\n",
+    "\n",
+    "# Define a GenericLocation for a region on the forward strand and link it to the sequence\n",
+    "forward_generic_location = sbol2.GenericLocation('forward_generic_location')\n",
+    "forward_generic_location.orientation = sbol2.SBOL_ORIENTATION_INLINE\n",
+    "forward_generic_location.sequence = comp_def.sequences[0]  # Reference the sequence in the ComponentDefinition\n",
+    "\n",
+    "# Add the GenericLocation to the SequenceAnnotation\n",
+    "forward_annotation.locations.add(forward_generic_location)\n",
+    "\n",
+    "# Add the SequenceAnnotation to the ComponentDefinition\n",
+    "comp_def.sequenceAnnotations.add(forward_annotation)\n",
+    "\n",
+    "# --- GenericLocation 2: Reverse Complement Strand (SBOL_ORIENTATION_REVERSE_COMPLEMENT) without sequence reference ---\n",
+    "# Create a SequenceAnnotation for a region on the reverse complement strand\n",
+    "reverse_annotation = sbol2.SequenceAnnotation('reverse_region_annotation')\n",
+    "\n",
+    "# Define a GenericLocation for a region on the reverse complement strand (no sequence reference)\n",
+    "reverse_generic_location = sbol2.GenericLocation('reverse_generic_location')\n",
+    "reverse_generic_location.orientation = sbol2.SBOL_ORIENTATION_REVERSE_COMPLEMENT\n",
+    "\n",
+    "# Add the GenericLocation to the SequenceAnnotation\n",
+    "reverse_annotation.locations.add(reverse_generic_location)\n",
+    "\n",
+    "# Add the SequenceAnnotation to the ComponentDefinition\n",
+    "comp_def.sequenceAnnotations.add(reverse_annotation)"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 18,
+   "metadata": {},
+   "outputs": [
+    {
+     "data": {
+      "text/plain": [
+       "'Valid.'"
+      ]
+     },
+     "execution_count": 18,
+     "metadata": {},
+     "output_type": "execute_result"
+    }
+   ],
+   "source": [
+    "# Validate the document to ensure compliance with SBOL standards\n",
+    "doc.validate()"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 19,
+   "metadata": {},
+   "outputs": [
+    {
+     "data": {
+      "text/plain": [
+       "'Valid.'"
+      ]
+     },
+     "execution_count": 19,
+     "metadata": {},
+     "output_type": "execute_result"
+    }
+   ],
+   "source": [
+    "# Save the document to an SBOL file\n",
+    "doc.write('generic_location_example.xml')"
+   ]
+  }
+ ],
+ "metadata": {
+  "kernelspec": {
+   "display_name": "sbol_env",
+   "language": "python",
+   "name": "python3"
+  },
+  "language_info": {
+   "codemirror_mode": {
+    "name": "ipython",
+    "version": 3
+   },
+   "file_extension": ".py",
+   "mimetype": "text/x-python",
+   "name": "python",
+   "nbconvert_exporter": "python",
+   "pygments_lexer": "ipython3",
+   "version": "3.11.6"
+  }
+ },
+ "nbformat": 4,
+ "nbformat_minor": 2
+}