removed umitools extract

modules.json

@@ -45,14 +45,14 @@
             "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
             "installed_by": ["modules"]
           },
-          "umitools/dedup": {
+          "trimgalore": {
             "branch": "master",
-            "git_sha": "ff7e93715a2acecf3f143ec78c9858deba2984d0",
+            "git_sha": "d2c5e76f291379f3dd403e48e46ed7e6ba5da744",
             "installed_by": ["modules"]
           },
-          "umitools/extract": {
+          "umitools/dedup": {
             "branch": "master",
-            "git_sha": "d2c5e76f291379f3dd403e48e46ed7e6ba5da744",
+            "git_sha": "ff7e93715a2acecf3f143ec78c9858deba2984d0",
             "installed_by": ["modules"]
           }
         }

modules/nf-core/trimgalore/environment.yml

@@ -0,0 +1,8 @@
+name: trimgalore
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::trim-galore=0.6.7
+  - bioconda::cutadapt=3.4

modules/nf-core/trimgalore/main.nf

@@ -0,0 +1,75 @@
+process TRIMGALORE {
+    tag "$meta.id"
+    label 'process_high'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/trim-galore:0.6.7--hdfd78af_0' :
+        'biocontainers/trim-galore:0.6.7--hdfd78af_0' }"
+
+    input:
+    tuple val(meta), path(reads)
+
+    output:
+    tuple val(meta), path("*{3prime,5prime,trimmed,val}*.fq.gz"), emit: reads
+    tuple val(meta), path("*report.txt")                        , emit: log     , optional: true
+    tuple val(meta), path("*unpaired*.fq.gz")                   , emit: unpaired, optional: true
+    tuple val(meta), path("*.html")                             , emit: html    , optional: true
+    tuple val(meta), path("*.zip")                              , emit: zip     , optional: true
+    path "versions.yml"                                         , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    // Calculate number of --cores for TrimGalore based on value of task.cpus
+    // See: https://github.com/FelixKrueger/TrimGalore/blob/master/Changelog.md#version-060-release-on-1-mar-2019
+    // See: https://github.com/nf-core/atacseq/pull/65
+    def cores = 1
+    if (task.cpus) {
+        cores = (task.cpus as int) - 4
+        if (meta.single_end) cores = (task.cpus as int) - 3
+        if (cores < 1) cores = 1
+        if (cores > 8) cores = 8
+    }
+
+    // Added soft-links to original fastqs for consistent naming in MultiQC
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    if (meta.single_end) {
+        def args_list = args.split("\\s(?=--)").toList()
+        args_list.removeAll { it.toLowerCase().contains('_r2 ') }
+        """
+        [ ! -f  ${prefix}.fastq.gz ] && ln -s $reads ${prefix}.fastq.gz
+        trim_galore \\
+            ${args_list.join(' ')} \\
+            --cores $cores \\
+            --gzip \\
+            ${prefix}.fastq.gz
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            trimgalore: \$(echo \$(trim_galore --version 2>&1) | sed 's/^.*version //; s/Last.*\$//')
+            cutadapt: \$(cutadapt --version)
+        END_VERSIONS
+        """
+    } else {
+        """
+        [ ! -f  ${prefix}_1.fastq.gz ] && ln -s ${reads[0]} ${prefix}_1.fastq.gz
+        [ ! -f  ${prefix}_2.fastq.gz ] && ln -s ${reads[1]} ${prefix}_2.fastq.gz
+        trim_galore \\
+            $args \\
+            --cores $cores \\
+            --paired \\
+            --gzip \\
+            ${prefix}_1.fastq.gz \\
+            ${prefix}_2.fastq.gz
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            trimgalore: \$(echo \$(trim_galore --version 2>&1) | sed 's/^.*version //; s/Last.*\$//')
+            cutadapt: \$(cutadapt --version)
+        END_VERSIONS
+        """
+    }
+}

modules/nf-core/trimgalore/meta.yml

@@ -0,0 +1,68 @@
+name: trimgalore
+description: Trim FastQ files using Trim Galore!
+keywords:
+  - trimming
+  - adapters
+  - sequencing adapters
+  - fastq
+tools:
+  - trimgalore:
+      description: |
+        A wrapper tool around Cutadapt and FastQC to consistently apply quality
+        and adapter trimming to FastQ files, with some extra functionality for
+        MspI-digested RRBS-type (Reduced Representation Bisufite-Seq) libraries.
+      homepage: https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/
+      documentation: https://github.com/FelixKrueger/TrimGalore/blob/master/Docs/Trim_Galore_User_Guide.md
+      licence: ["GPL-3.0-or-later"]
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+      type: file
+      description: |
+        List of input FastQ files of size 1 and 2 for single-end and paired-end data,
+        respectively.
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+      type: file
+      description: |
+        List of input adapter trimmed FastQ files of size 1 and 2 for
+        single-end and paired-end data, respectively.
+      pattern: "*{3prime,5prime,trimmed,val}*.fq.gz"
+  - unpaired:
+      type: file
+      description: |
+        FastQ files containing unpaired reads from read 1 or read 2
+      pattern: "*unpaired*.fq.gz"
+  - html:
+      type: file
+      description: FastQC report (optional)
+      pattern: "*_{fastqc.html}"
+  - zip:
+      type: file
+      description: FastQC report archive (optional)
+      pattern: "*_{fastqc.zip}"
+  - log:
+      type: file
+      description: Trim Galore! trimming report
+      pattern: "*_{report.txt}"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+authors:
+  - "@drpatelh"
+  - "@ewels"
+  - "@FelixKrueger"
+maintainers:
+  - "@drpatelh"
+  - "@ewels"
+  - "@FelixKrueger"

modules/nf-core/trimgalore/tests/main.nf.test

@@ -0,0 +1,103 @@
+nextflow_process {
+
+    name "Test Process TRIMGALORE"
+    script "../main.nf"
+    process "TRIMGALORE"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "trimgalore"
+
+    test("test_trimgalore_single_end") {
+
+        when {
+            process {
+                """
+                input[0] = [ [ id:'test', single_end:true ], // meta map
+                    [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
+								"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
+								"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
+								"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
+								"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
+								"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
+            def report1_lines = ["1	19	25.0	0	19",
+                                    "2	10	6.2	0	10",
+                                    "3	1	1.6	0	1"]
+            assertAll(
+                { assert process.success },
+                { read_lines.each { read_line ->
+                    { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
+                    }
+                },
+                { report1_lines.each { report1_line ->
+                    { assert path(process.out.log.get(0).get(1)).getText().contains(report1_line) }
+                    }
+                },
+                { assert snapshot(process.out.versions).match() }
+            )
+        }
+    }
+
+    test("test_trimgalore_paired_end") {
+
+        when {
+            process {
+                """
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true),
+                        file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true)
+                    ]
+                ]
+                """
+            }
+        }
+
+        then {
+            def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
+									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
+									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
+									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
+									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
+									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
+            def read2_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/2",
+									"ATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTG",
+									"AAAAAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEEEEAEEEEEAAEEEEEEEEEAAEAAA<<EAAEEEEEEEAAA<<<AE",
+									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/2",
+									"GCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGT",
+									"AAAAA6EEAEEEEEAEEAEEAEEEEEEA6EEEEAEEAEEEEE6EEEEEEAEEEEA///A<<EEEEEEEEEAEEEEEE"]
+            def report1_lines = ["1	19	25.0	0	19",
+                                    "2	10	6.2	0	10",
+                                    "3	1	1.6	0	1"]
+            def report2_lines = ["1	28	25.0	0	28",
+                                    "2	10	6.2	0	10",
+                                    "3	1	1.6	0	1"]
+            assertAll(
+                { assert process.success },
+                { read1_lines.each { read1_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
+                    }
+                },
+                { read2_lines.each { read2_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
+                    }
+                },
+                { report1_lines.each { report1_line ->
+                    { assert path(process.out.log.get(0).get(1).get(0)).getText().contains(report1_line) }
+                    }
+                },
+                { report2_lines.each { report2_line ->
+                    { assert path(process.out.log.get(0).get(1).get(1)).getText().contains(report2_line) }
+                    }
+                },
+                { assert snapshot(process.out.versions).match() }
+            )
+        }
+    }
+}

modules/nf-core/trimgalore/tests/main.nf.test.snap

@@ -0,0 +1,26 @@
+{
+    "test_trimgalore_single_end": {
+        "content": [
+            [
+                "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.01.0"
+        },
+        "timestamp": "2024-02-29T16:33:20.401347"
+    },
+    "test_trimgalore_paired_end": {
+        "content": [
+            [
+                "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.01.0"
+        },
+        "timestamp": "2024-02-29T16:33:28.960497"
+    }
+}

modules/nf-core/trimgalore/tests/tags.yml

@@ -0,0 +1,2 @@
+trimgalore:
+  - modules/nf-core/trimgalore/**