Reads_loading,_QC,_Nextflow.ipynb

{
  "cells": [
    {
      "cell_type": "markdown",
      "metadata": {
        "id": "view-in-github",
        "colab_type": "text"
      },
      "source": [
        "<a href=\"https://colab.research.google.com/github/andrrrsss/Nextflow_gene_expression/blob/main/Reads_loading%2C_QC%2C_Nextflow.ipynb\" target=\"_parent\"><img src=\"https://colab.research.google.com/assets/colab-badge.svg\" alt=\"Open In Colab\"/></a>"
      ]
    },
    {
      "cell_type": "markdown",
      "metadata": {
        "id": "6Oo_Qo8dcnth"
      },
      "source": [
        "## Reads loading"
      ]
    },
    {
      "cell_type": "markdown",
      "metadata": {
        "id": "bI4GQExsmKSP"
      },
      "source": [
        "### SRA Toolkit"
      ]
    },
    {
      "cell_type": "markdown",
      "metadata": {
        "id": "Pu1G84tsmmxM"
      },
      "source": [
        "In order to load the SRA experiment and convert it to .fastq reads (we will do this at the same time with one command, but you can run them independently), you need to run the following commands. First, we will download the SRA Toolkit from the NCBI website:"
      ]
    },
    {
      "cell_type": "code",
      "execution_count": null,
      "metadata": {
        "id": "8Io2LvW2fW-L",
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "outputId": "7176e635-e883-40d6-c959-1b84c844a4cb"
      },
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "--2023-01-04 17:32:46--  https://ftp-trace.ncbi.nlm.nih.gov/sra/sdk/3.0.0/sratoolkit.3.0.0-ubuntu64.tar.gz\n",
            "Resolving ftp-trace.ncbi.nlm.nih.gov (ftp-trace.ncbi.nlm.nih.gov)... 130.14.250.11, 130.14.250.12, 2607:f220:41e:250::10, ...\n",
            "Connecting to ftp-trace.ncbi.nlm.nih.gov (ftp-trace.ncbi.nlm.nih.gov)|130.14.250.11|:443... connected.\n",
            "HTTP request sent, awaiting response... 200 OK\n",
            "Length: 85777118 (82M) [application/x-gzip]\n",
            "Saving to: ‘sratoolkit.3.0.0-ubuntu64.tar.gz’\n",
            "\n",
            "sratoolkit.3.0.0-ub 100%[===================>]  81.80M  15.5MB/s    in 6.6s    \n",
            "\n",
            "2023-01-04 17:32:54 (12.4 MB/s) - ‘sratoolkit.3.0.0-ubuntu64.tar.gz’ saved [85777118/85777118]\n",
            "\n",
            "sratoolkit.3.0.0-ubuntu64/\n",
            "sratoolkit.3.0.0-ubuntu64/bin/\n",
            "sratoolkit.3.0.0-ubuntu64/bin/abi-dump\n",
            "sratoolkit.3.0.0-ubuntu64/bin/abi-dump.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/abi-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/abi-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/align-info\n",
            "sratoolkit.3.0.0-ubuntu64/bin/align-info.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/bam-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/bam-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/cache-mgr\n",
            "sratoolkit.3.0.0-ubuntu64/bin/cache-mgr.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/cg-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/cg-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/dump-ref-fasta\n",
            "sratoolkit.3.0.0-ubuntu64/bin/dump-ref-fasta.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fasterq-dump\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fasterq-dump.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fasterq-dump.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fastq-dump\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fastq-dump.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fastq-dump.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fastq-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fastq-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/helicos-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/helicos-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/illumina-dump\n",
            "sratoolkit.3.0.0-ubuntu64/bin/illumina-dump.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/illumina-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/illumina-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/kar\n",
            "sratoolkit.3.0.0-ubuntu64/bin/kar.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/kdbmeta\n",
            "sratoolkit.3.0.0-ubuntu64/bin/kdbmeta.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/latf-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/latf-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/pacbio-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/pacbio-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/prefetch\n",
            "sratoolkit.3.0.0-ubuntu64/bin/prefetch.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/prefetch.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/rcexplain\n",
            "sratoolkit.3.0.0-ubuntu64/bin/rcexplain.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sam-dump\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sam-dump.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sam-dump.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sff-dump\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sff-dump.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sff-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sff-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-pileup\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-pileup.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-pileup.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-search\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-search.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-sort\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-sort-cg\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-sort-cg.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-sort.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-stat\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-stat.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/srapath\n",
            "sratoolkit.3.0.0-ubuntu64/bin/srapath.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/srapath.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/srf-load\n",
            "sratoolkit.3.0.0-ubuntu64/bin/srf-load.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/test-sra\n",
            "sratoolkit.3.0.0-ubuntu64/bin/test-sra.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-config\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-config.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-copy\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-copy.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-decrypt\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-decrypt.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-dump\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-dump.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-dump.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-encrypt\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-encrypt.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-lock\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-lock.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-unlock\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-unlock.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-validate\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-validate.3\n",
            "sratoolkit.3.0.0-ubuntu64/bin/ncbi/\n",
            "sratoolkit.3.0.0-ubuntu64/bin/ncbi/certs.kfg\n",
            "sratoolkit.3.0.0-ubuntu64/bin/ncbi/default.kfg\n",
            "sratoolkit.3.0.0-ubuntu64/bin/ncbi/vdb-copy.kfg\n",
            "sratoolkit.3.0.0-ubuntu64/bin/srapath-orig.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sratools.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/srf-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/test-sra.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-config.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-copy.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-decrypt.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-dump-orig.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-encrypt.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-lock.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-unlock.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/vdb-validate.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/abi-dump.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/abi-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/align-info.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/bam-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/cache-mgr.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/cg-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/dump-ref-fasta.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fasterq-dump-orig.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fastq-dump-orig.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/fastq-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/helicos-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/illumina-dump.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/illumina-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/kar.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/kdbmeta.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/latf-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/pacbio-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/prefetch-orig.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/rcexplain.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sam-dump-orig.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sff-dump.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sff-load.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-pileup-orig.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-search.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-sort-cg.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-sort.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/bin/sra-stat.3.0.0\n",
            "sratoolkit.3.0.0-ubuntu64/example/\n",
            "sratoolkit.3.0.0-ubuntu64/example/perl/\n",
            "sratoolkit.3.0.0-ubuntu64/example/perl/base-stats.pl\n",
            "sratoolkit.3.0.0-ubuntu64/example/perl/dump-reference.pl\n",
            "sratoolkit.3.0.0-ubuntu64/example/perl/gene-lookup.pl\n",
            "sratoolkit.3.0.0-ubuntu64/example/perl/mismatch-stats.pl\n",
            "sratoolkit.3.0.0-ubuntu64/example/perl/quality-stats.pl\n",
            "sratoolkit.3.0.0-ubuntu64/example/perl/simplefastq.pl\n",
            "sratoolkit.3.0.0-ubuntu64/example/perl/splitfastq.pl\n",
            "sratoolkit.3.0.0-ubuntu64/README-blastn\n",
            "sratoolkit.3.0.0-ubuntu64/README-vdb-config\n",
            "sratoolkit.3.0.0-ubuntu64/schema/\n",
            "sratoolkit.3.0.0-ubuntu64/schema/align/\n",
            "sratoolkit.3.0.0-ubuntu64/schema/align/align.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/align/mate-cache.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/align/pileup-stats.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/align/qstat.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/align/refseq.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/align/seq.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/csra2/\n",
            "sratoolkit.3.0.0-ubuntu64/schema/csra2/csra2.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/csra2/read.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/csra2/reference.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/csra2/stats.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/insdc/\n",
            "sratoolkit.3.0.0-ubuntu64/schema/insdc/insdc.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/insdc/seq.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/insdc/sra.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/clip.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/ncbi.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/pnbrdb.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/seq-graph.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/seq.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/spotname.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/sra.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/stats.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/trace.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/varloc.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/ncbi/wgs-contig.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/454.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/abi.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/generic-fastq.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/helicos.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/illumina.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/ion-torrent.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/nanopore.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/pacbio.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/sra/pevents.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/vdb/\n",
            "sratoolkit.3.0.0-ubuntu64/schema/vdb/built-in.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/schema/vdb/vdb.vschema\n",
            "sratoolkit.3.0.0-ubuntu64/CHANGES\n",
            "sratoolkit.3.0.0-ubuntu64/README.md\n"
          ]
        }
      ],
      "source": [
        "!wget https://ftp-trace.ncbi.nlm.nih.gov/sra/sdk/3.0.0/sratoolkit.3.0.0-ubuntu64.tar.gz\n",
        "!tar -xvzf sratoolkit.3.0.0-ubuntu64.tar.gz"
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "We need to download the reads using the <code>fasterq-dump</code> program from the SRA Toolkit. It is extremely difficult to set up the SRA Toolkit correctly inside Google Colab, so you will need to perform some strange procedure: specifically cause a Segmentation fault in the <code>vdb-config</code> tool."
      ],
      "metadata": {
        "id": "A7Pi8Jvhnwpv"
      }
    },
    {
      "cell_type": "code",
      "execution_count": null,
      "metadata": {
        "id": "dTfvxgxCfnBi",
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "outputId": "68e33a33-3ddb-40ba-9648-8beddba17255"
      },
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "\u001b[2J\u001b[?25l\u001b[?1000h\u001b[?1002h2023-01-04T17:33:08 vdb-config.3.0.0 fatal: SIGNAL - Segmentation fault \n"
          ]
        }
      ],
      "source": [
        "!sratoolkit.3.0.0-ubuntu64/bin/vdb-config -i"
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "Now we can safely run fastq-dump and unzip our reads:\n",
        "\n",
        "\n"
      ],
      "metadata": {
        "id": "5Zv1dtd7o7S9"
      }
    },
    {
      "cell_type": "code",
      "source": [
        "!sratoolkit.3.0.0-ubuntu64/bin/fasterq-dump SRR3900953"
      ],
      "metadata": {
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "id": "Oww6_RFqnMDT",
        "outputId": "ef487fe0-e356-419f-9997-9a6eaeb0a29e"
      },
      "execution_count": null,
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "spots read      : 4,941,237\n",
            "reads read      : 9,882,474\n",
            "reads written   : 9,882,474\n"
          ]
        }
      ]
    },
    {
      "cell_type": "code",
      "source": [
        "!tail SRR3900953_1.fastq"
      ],
      "metadata": {
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "id": "9CiTchhspfjm",
        "outputId": "2fc6c417-a1a8-46ca-85a7-90a7061a4649"
      },
      "execution_count": null,
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "+SRR3900953.4941235 8_2316_17189_101340_2 length=60\n",
            "CCCCCGGGCGGGGGGGGGCGGGGGEG@@FGGGGGGF>FGEFGGG>EGAGBFGGCF>GBG1\n",
            "@SRR3900953.4941236 8_2316_17335_101333_2 length=60\n",
            "CATGCGGTTTGGATGTGTTTGTTGAATGCAAGCCTGTGGAGGCGTTAACGTCTCAGTTAC\n",
            "+SRR3900953.4941236 8_2316_17335_101333_2 length=60\n",
            "BBCCCEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG\n",
            "@SRR3900953.4941237 8_2316_17416_101338_2 length=60\n",
            "CATGCCTGGTGTAAGGAAAATATCTGAGAACCGTCAGTGCAAAATCCATGCAATGTGGCC\n",
            "+SRR3900953.4941237 8_2316_17416_101338_2 length=60\n",
            "BCCBCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEG\n"
          ]
        }
      ]
    },
    {
      "cell_type": "code",
      "source": [
        "!head SRR3900953_1.fastq"
      ],
      "metadata": {
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "id": "_RboDqSpGbHg",
        "outputId": "dbc2f7b6-b2cf-4d9a-c862-d436b600b8de"
      },
      "execution_count": null,
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "@SRR3900953.1 8_1101_5015_2203_1 length=60\n",
            "AATTCCACAAAAAACTGGCATAGAAGCAATAGGAAAAATACTTGCCAGCACTGAAAAAAT\n",
            "+SRR3900953.1 8_1101_5015_2203_1 length=60\n",
            "GGGGGGCGGGEGGDDFDGGGGEGGGCGGGGGG:@GGGGGGGGGGGGGEGEFC1E@DGGFG\n",
            "@SRR3900953.2 8_1101_5654_2168_1 length=60\n",
            "AATTCTGTGAATGTTTGAAGCAGACATCTAATGGAATGGAATGCGTAAACAGCACTGTAG\n",
            "+SRR3900953.2 8_1101_5654_2168_1 length=60\n",
            "GGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGG\n",
            "@SRR3900953.3 8_1101_6213_2231_1 length=60\n",
            "AATTCATCATCTTTCCCCCACCTCACTCTACCCCTTCACCAGACCTATCCATCAATGTCA\n"
          ]
        }
      ]
    },
    {
      "cell_type": "markdown",
      "metadata": {
        "id": "l2PwnKaKmdtB"
      },
      "source": [
        "### SRA Explorer"
      ]
    },
    {
      "cell_type": "markdown",
      "metadata": {
        "id": "cIYjJgzgmpv1"
      },
      "source": [
        "\n",
        "However, in addition to the options for downloading from SRA using the SRA Toolkit, you can try downloading the reads using the SRA Explorer web page  <a href=\"https://sra-explorer.info/\">SRA Explorer</a> &mdash; - in this case, the user will simply be provided with direct links to the reads, as well as a lot of additional information. However, this does not always really help. Let's see what the result will be when downloading the readings of the same experiment from this service:"
      ]
    },
    {
      "cell_type": "code",
      "execution_count": null,
      "metadata": {
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "id": "ISnLFse3XEwB",
        "outputId": "c01cb4da-7173-4721-cb59-cd24aac2f4f2"
      },
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "--2023-01-04 17:36:53--  ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR390/003/SRR3900953/SRR3900953_1.fastq.gz\n",
            "           => ‘SRR3900953_1.fastq.gz’\n",
            "Resolving ftp.sra.ebi.ac.uk (ftp.sra.ebi.ac.uk)... 193.62.193.138\n",
            "Connecting to ftp.sra.ebi.ac.uk (ftp.sra.ebi.ac.uk)|193.62.193.138|:21... connected.\n",
            "Logging in as anonymous ... Logged in!\n",
            "==> SYST ... done.    ==> PWD ... done.\n",
            "==> TYPE I ... done.  ==> CWD (1) /vol1/fastq/SRR390/003/SRR3900953 ... done.\n",
            "==> SIZE SRR3900953_1.fastq.gz ... 196393222\n",
            "==> PASV ... done.    ==> RETR SRR3900953_1.fastq.gz ... done.\n",
            "Length: 196393222 (187M) (unauthoritative)\n",
            "\n",
            "SRR3900953_1.fastq. 100%[===================>] 187.29M  11.1MB/s    in 20s     \n",
            "\n",
            "2023-01-04 17:37:17 (9.58 MB/s) - ‘SRR3900953_1.fastq.gz’ saved [196393222]\n",
            "\n",
            "--2023-01-04 17:37:17--  ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR390/003/SRR3900953/SRR3900953_2.fastq.gz\n",
            "           => ‘SRR3900953_2.fastq.gz’\n",
            "Resolving ftp.sra.ebi.ac.uk (ftp.sra.ebi.ac.uk)... 193.62.193.138\n",
            "Connecting to ftp.sra.ebi.ac.uk (ftp.sra.ebi.ac.uk)|193.62.193.138|:21... connected.\n",
            "Logging in as anonymous ... Logged in!\n",
            "==> SYST ... done.    ==> PWD ... done.\n",
            "==> TYPE I ... done.  ==> CWD (1) /vol1/fastq/SRR390/003/SRR3900953 ... done.\n",
            "==> SIZE SRR3900953_2.fastq.gz ... 223659231\n",
            "==> PASV ... done.    ==> RETR SRR3900953_2.fastq.gz ... done.\n",
            "Length: 223659231 (213M) (unauthoritative)\n",
            "\n",
            "SRR3900953_2.fastq. 100%[===================>] 213.30M  11.2MB/s    in 22s     \n",
            "\n",
            "2023-01-04 17:37:42 (9.84 MB/s) - ‘SRR3900953_2.fastq.gz’ saved [223659231]\n",
            "\n"
          ]
        }
      ],
      "source": [
        "!wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR390/003/SRR3900953/SRR3900953_1.fastq.gz\n",
        "!wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR390/003/SRR3900953/SRR3900953_2.fastq.gz"
      ]
    },
    {
      "cell_type": "markdown",
      "metadata": {
        "id": "upB-1luOndSV"
      },
      "source": [
        "## Read quality control"
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "### FastQC\n",
        "\n",
        "To begin with, we will download the program with which we will evaluate the quality, &mdash; <code>FastQC</code>."
      ],
      "metadata": {
        "id": "yaAbLnqz8Gz-"
      }
    },
    {
      "cell_type": "code",
      "execution_count": null,
      "metadata": {
        "id": "u4IUo_zmeF5O",
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "outputId": "d817e38e-2124-4669-f81b-18ec5bd760a7"
      },
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "--2023-01-04 18:01:46--  https://www.bioinformatics.babraham.ac.uk/projects/fastqc/fastqc_v0.11.9.zip\n",
            "Resolving www.bioinformatics.babraham.ac.uk (www.bioinformatics.babraham.ac.uk)... 149.155.133.4\n",
            "Connecting to www.bioinformatics.babraham.ac.uk (www.bioinformatics.babraham.ac.uk)|149.155.133.4|:443... connected.\n",
            "HTTP request sent, awaiting response... 200 OK\n",
            "Length: 10249221 (9.8M) [application/zip]\n",
            "Saving to: ‘fastqc_v0.11.9.zip’\n",
            "\n",
            "fastqc_v0.11.9.zip  100%[===================>]   9.77M  1.98MB/s    in 4.9s    \n",
            "\n",
            "2023-01-04 18:01:52 (1.98 MB/s) - ‘fastqc_v0.11.9.zip’ saved [10249221/10249221]\n",
            "\n",
            "Archive:  fastqc_v0.11.9.zip\n",
            "  inflating: FastQC/cisd-jhdf5.jar   \n",
            "   creating: FastQC/Configuration/\n",
            "  inflating: FastQC/Configuration/adapter_list.txt  \n",
            "  inflating: FastQC/Configuration/contaminant_list.txt  \n",
            "  inflating: FastQC/Configuration/limits.txt  \n",
            "  inflating: FastQC/fastqc           \n",
            "  inflating: FastQC/fastqc_icon.ico  \n",
            "   creating: FastQC/Help/\n",
            "   creating: FastQC/Help/1 Introduction/\n",
            "   creating: FastQC/Help/1 Introduction/.svn/\n",
            "  inflating: FastQC/Help/1 Introduction/.svn/entries  \n",
            "   creating: FastQC/Help/1 Introduction/.svn/props/\n",
            "   creating: FastQC/Help/1 Introduction/.svn/text-base/\n",
            "  inflating: FastQC/Help/1 Introduction/.svn/text-base/1.1 What is FastQC.html.svn-base  \n",
            "   creating: FastQC/Help/1 Introduction/.svn/tmp/\n",
            "   creating: FastQC/Help/1 Introduction/.svn/tmp/props/\n",
            "  inflating: FastQC/Help/1 Introduction/1.1 What is FastQC.html  \n",
            "   creating: FastQC/Help/2 Basic Operations/\n",
            "   creating: FastQC/Help/2 Basic Operations/.svn/\n",
            "  inflating: FastQC/Help/2 Basic Operations/.svn/entries  \n",
            "   creating: FastQC/Help/2 Basic Operations/.svn/props/\n",
            "   creating: FastQC/Help/2 Basic Operations/.svn/text-base/\n",
            "  inflating: FastQC/Help/2 Basic Operations/.svn/text-base/2.1 Opening a sequence file.html.svn-base  \n",
            "  inflating: FastQC/Help/2 Basic Operations/.svn/text-base/2.2 Evaluating Results.html.svn-base  \n",
            "  inflating: FastQC/Help/2 Basic Operations/.svn/text-base/2.3 Saving a Report.html.svn-base  \n",
            "   creating: FastQC/Help/2 Basic Operations/.svn/tmp/\n",
            "   creating: FastQC/Help/2 Basic Operations/.svn/tmp/props/\n",
            "  inflating: FastQC/Help/2 Basic Operations/2.1 Opening a sequence file.html  \n",
            "  inflating: FastQC/Help/2 Basic Operations/2.2 Evaluating Results.html  \n",
            "  inflating: FastQC/Help/2 Basic Operations/2.3 Saving a Report.html  \n",
            "   creating: FastQC/Help/3 Analysis Modules/\n",
            "   creating: FastQC/Help/3 Analysis Modules/.svn/\n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/entries  \n",
            "   creating: FastQC/Help/3 Analysis Modules/.svn/prop-base/\n",
            " extracting: FastQC/Help/3 Analysis Modules/.svn/prop-base/duplication_levels.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/prop-base/kmer_profiles.png.svn-base  \n",
            " extracting: FastQC/Help/3 Analysis Modules/.svn/prop-base/per_base_gc_content.png.svn-base  \n",
            " extracting: FastQC/Help/3 Analysis Modules/.svn/prop-base/per_base_n_content.png.svn-base  \n",
            " extracting: FastQC/Help/3 Analysis Modules/.svn/prop-base/per_base_quality.png.svn-base  \n",
            " extracting: FastQC/Help/3 Analysis Modules/.svn/prop-base/per_base_sequence_content.png.svn-base  \n",
            " extracting: FastQC/Help/3 Analysis Modules/.svn/prop-base/per_sequence_gc_content.png.svn-base  \n",
            " extracting: FastQC/Help/3 Analysis Modules/.svn/prop-base/per_sequence_quality.png.svn-base  \n",
            " extracting: FastQC/Help/3 Analysis Modules/.svn/prop-base/per_tile_quality.png.svn-base  \n",
            " extracting: FastQC/Help/3 Analysis Modules/.svn/prop-base/sequence_length_distribution.png.svn-base  \n",
            "   creating: FastQC/Help/3 Analysis Modules/.svn/props/\n",
            "   creating: FastQC/Help/3 Analysis Modules/.svn/text-base/\n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/1 Basic Statistics.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/10 Adapter Content.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/11 Kmer Content.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/12 Per Tile Sequence Quality.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/2 Per Base Sequence Quality.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/3 Per Sequence Quality Scores.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/4 Per Base Sequence Content.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/5 Per Sequence GC Content.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/6 Per Base N Content.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/7 Sequence Length Distribution.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/8 Duplicate Sequences.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/9 Overrepresented Sequences.html.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/duplication_levels.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/kmer_profiles.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/per_base_gc_content.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/per_base_n_content.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/per_base_quality.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/per_base_sequence_content.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/per_sequence_gc_content.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/per_sequence_quality.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/per_tile_quality.png.svn-base  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/.svn/text-base/sequence_length_distribution.png.svn-base  \n",
            "   creating: FastQC/Help/3 Analysis Modules/.svn/tmp/\n",
            "   creating: FastQC/Help/3 Analysis Modules/.svn/tmp/props/\n",
            "  inflating: FastQC/Help/3 Analysis Modules/1 Basic Statistics.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/10 Adapter Content.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/11 Kmer Content.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/12 Per Tile Sequence Quality.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/2 Per Base Sequence Quality.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/3 Per Sequence Quality Scores.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/4 Per Base Sequence Content.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/5 Per Sequence GC Content.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/6 Per Base N Content.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/7 Sequence Length Distribution.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/8 Duplicate Sequences.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/9 Overrepresented Sequences.html  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/duplication_levels.png  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/kmer_profiles.png  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/per_base_gc_content.png  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/per_base_n_content.png  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/per_base_quality.png  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/per_base_sequence_content.png  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/per_sequence_gc_content.png  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/per_sequence_quality.png  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/per_tile_quality.png  \n",
            "  inflating: FastQC/Help/3 Analysis Modules/sequence_length_distribution.png  \n",
            "  inflating: FastQC/INSTALL.txt      \n",
            "  inflating: FastQC/jbzip2-0.9.jar   \n",
            "  inflating: FastQC/LICENSE          \n",
            "  inflating: FastQC/LICENSE.txt      \n",
            "  inflating: FastQC/LICENSE_JHDF5.txt  \n",
            "   creating: FastQC/net/\n",
            "   creating: FastQC/net/sourceforge/\n",
            "   creating: FastQC/net/sourceforge/iharder/\n",
            "   creating: FastQC/net/sourceforge/iharder/base64/\n",
            "  inflating: FastQC/net/sourceforge/iharder/base64/Base64$1.class  \n",
            "  inflating: FastQC/net/sourceforge/iharder/base64/Base64$InputStream.class  \n",
            "  inflating: FastQC/net/sourceforge/iharder/base64/Base64$OutputStream.class  \n",
            "  inflating: FastQC/net/sourceforge/iharder/base64/Base64.class  \n",
            "   creating: FastQC/org/\n",
            "   creating: FastQC/org/apache/\n",
            "   creating: FastQC/org/apache/commons/\n",
            "   creating: FastQC/org/apache/commons/math3/\n",
            "   creating: FastQC/org/apache/commons/math3/analysis/\n",
            "   creating: FastQC/org/apache/commons/math3/analysis/solvers/\n",
            "  inflating: FastQC/org/apache/commons/math3/analysis/solvers/AbstractUnivariateSolver.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/analysis/solvers/AllowedSolution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/analysis/solvers/BaseAbstractUnivariateSolver.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/analysis/solvers/BaseUnivariateSolver.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/analysis/solvers/BracketedUnivariateSolver.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/analysis/solvers/BrentSolver.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/analysis/solvers/UnivariateSolver.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/analysis/solvers/UnivariateSolverUtils.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/analysis/UnivariateFunction.class  \n",
            "   creating: FastQC/org/apache/commons/math3/distribution/\n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/AbstractIntegerDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/AbstractRealDistribution$1.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/AbstractRealDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/BetaDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/BinomialDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/CauchyDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/ChiSquaredDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/FDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/GammaDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/HypergeometricDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/IntegerDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/NormalDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/PascalDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/PoissonDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/RealDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/SaddlePointExpansion.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/TDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/WeibullDistribution.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/distribution/ZipfDistribution.class  \n",
            "   creating: FastQC/org/apache/commons/math3/exception/\n",
            "  inflating: FastQC/org/apache/commons/math3/exception/ConvergenceException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/DimensionMismatchException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/MathArithmeticException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/MathIllegalArgumentException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/MathIllegalNumberException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/MathIllegalStateException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/MathInternalError.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/MaxCountExceededException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/NoBracketingException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/NotFiniteNumberException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/NotPositiveException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/NotStrictlyPositiveException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/NullArgumentException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/NumberIsTooLargeException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/NumberIsTooSmallException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/OutOfRangeException.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/TooManyEvaluationsException.class  \n",
            "   creating: FastQC/org/apache/commons/math3/exception/util/\n",
            "  inflating: FastQC/org/apache/commons/math3/exception/util/ArgUtils.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/util/ExceptionContext.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/util/ExceptionContextProvider.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/util/Localizable.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/exception/util/LocalizedFormats.class  \n",
            "   creating: FastQC/org/apache/commons/math3/random/\n",
            "  inflating: FastQC/org/apache/commons/math3/random/AbstractWell.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/random/BitsStreamGenerator.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/random/RandomData.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/random/RandomDataImpl.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/random/RandomGenerator.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/random/Well19937c.class  \n",
            "   creating: FastQC/org/apache/commons/math3/special/\n",
            "  inflating: FastQC/org/apache/commons/math3/special/Beta$1.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/special/Beta.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/special/Erf.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/special/Gamma$1.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/special/Gamma.class  \n",
            "   creating: FastQC/org/apache/commons/math3/util/\n",
            "  inflating: FastQC/org/apache/commons/math3/util/ArithmeticUtils.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/ContinuedFraction.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/DoubleArray.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/FastMath$ExpFracTable.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/FastMath$ExpIntTable.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/FastMath$lnMant.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/FastMath.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/FastMathCalc.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/FastMathLiteralArrays.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/Incrementor$1.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/Incrementor$MaxCountExceededCallback.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/Incrementor.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/MathUtils.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/Precision.class  \n",
            "  inflating: FastQC/org/apache/commons/math3/util/ResizableDoubleArray.class  \n",
            "  inflating: FastQC/README.md        \n",
            "  inflating: FastQC/README.txt       \n",
            "  inflating: FastQC/RELEASE_NOTES.txt  \n",
            "  inflating: FastQC/run_fastqc.bat   \n",
            "  inflating: FastQC/sam-1.103.jar    \n",
            "   creating: FastQC/Templates/\n",
            "  inflating: FastQC/Templates/fastqc2fo.xsl  \n",
            "  inflating: FastQC/Templates/header_template.html  \n",
            "   creating: FastQC/Templates/Icons/\n",
            " extracting: FastQC/Templates/Icons/error.png  \n",
            " extracting: FastQC/Templates/Icons/fastqc_icon.png  \n",
            " extracting: FastQC/Templates/Icons/tick.png  \n",
            " extracting: FastQC/Templates/Icons/warning.png  \n",
            "   creating: FastQC/uk/\n",
            "   creating: FastQC/uk/ac/\n",
            "   creating: FastQC/uk/ac/babraham/\n",
            "   creating: FastQC/uk/ac/babraham/FastQC/\n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Analysis/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Analysis/AnalysisListener.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Analysis/AnalysisQueue.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Analysis/AnalysisRunner.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Analysis/OfflineRunner.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Dialogs/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Dialogs/AboutDialog$1.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Dialogs/AboutDialog.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel$SmoothJLabel.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Dialogs/WelcomePanel.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FastQCApplication$1.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FastQCApplication.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FastQCConfig.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FastQCMenuBar.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/FileFilters/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FileFilters/BAMFileFilter.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FileFilters/CasavaFastQFileFilter.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FileFilters/FastQFileFilter.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FileFilters/GobyFileFilter.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FileFilters/MappedBAMFileFilter.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/FileFilters/SequenceFileFilter.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Graphs/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Graphs/BaseGroup.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Graphs/LineGraph.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Graphs/QualityBoxPlot.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Graphs/TileGraph.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Help/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Help/HelpDialog.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Help/HelpIndexRoot$FileSorter.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Help/HelpIndexRoot.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Help/HelpPage.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Help/HelpPageDisplay$HelpEditor.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Help/HelpPageDisplay.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Help/HelpSearchPanel.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Modules/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/AbstractQCModule.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/AdapterContent$Adapter.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/AdapterContent$ResultsTable.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/AdapterContent.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/BasicStats$ResultsTable.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/BasicStats.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/DuplicationLevel.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Modules/GCModel/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/GCModel/GCModel.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/GCModel/GCModelValue.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/KmerContent$Kmer.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/KmerContent$ResultsTable.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/KmerContent.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/ModuleConfig.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/ModuleFactory.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/NContent.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$OverrepresentedSeq.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$ResultsTable.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/PerBaseQualityScores.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/PerBaseSequenceContent.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/PerSequenceGCContent.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/PerSequenceQualityScores.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/PerTileQualityScores.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/QCModule.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Modules/SequenceLengthDistribution.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Report/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Report/HTMLReportArchive.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Report/stylesheet.txt  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Resources/\n",
            " extracting: FastQC/uk/ac/babraham/FastQC/Resources/error.png  \n",
            " extracting: FastQC/uk/ac/babraham/FastQC/Resources/fastqc_icon.png  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Resources/fastqc_icon.svg  \n",
            " extracting: FastQC/uk/ac/babraham/FastQC/Resources/fastqc_icon_100.png  \n",
            " extracting: FastQC/uk/ac/babraham/FastQC/Resources/tick.png  \n",
            " extracting: FastQC/uk/ac/babraham/FastQC/Resources/warning.png  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Results/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Results/ResultsPanel$ModuleRenderer.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Results/ResultsPanel.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Sequence/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/BAMFile.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Sequence/Contaminant/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/Contaminant/Contaminant.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminantHit.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminentFinder.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/Fast5File.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/FastQFile.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Sequence/QualityEncoding/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/QualityEncoding/PhredEncoding.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/Sequence.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/SequenceFactory.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/SequenceFile.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/SequenceFileGroup.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Sequence/SequenceFormatException.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Statistics/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Statistics/NormalDistribution.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Statistics/PearsonCorrelation.class  \n",
            "   creating: FastQC/uk/ac/babraham/FastQC/Utilities/\n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Utilities/CasavaBasename.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Utilities/HotColdColourGradient.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Utilities/ImageToBase64.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Utilities/MultiMemberGZIPInputStream.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Utilities/NameFormatException.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Utilities/NanoporeBasename.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Utilities/QualityCount.class  \n",
            "  inflating: FastQC/uk/ac/babraham/FastQC/Utilities/RGB.class  \n"
          ]
        }
      ],
      "source": [
        "!wget https://www.bioinformatics.babraham.ac.uk/projects/fastqc/fastqc_v0.11.9.zip\n",
        "!unzip fastqc_v0.11.9.zip"
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "Then we make the script <code>fastqc</code> executable. As a result, we will analyze the quality of our reads and put the results and all reports in the <code>qc</code> folder, which we will create before."
      ],
      "metadata": {
        "id": "F5WJVvst7w4k"
      }
    },
    {
      "cell_type": "code",
      "source": [
        "!chmod +x FastQC/fastqc\n",
        "!mkdir qc\n",
        "!FastQC/fastqc -o qc SRR3900953_1.fastq.gz SRR3900953_2.fastq.gz"
      ],
      "metadata": {
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "id": "TcxzHdIr7Rpe",
        "outputId": "f71f6118-a728-4754-a5af-3232491d1a97"
      },
      "execution_count": null,
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "Started analysis of SRR3900953_1.fastq.gz\n",
            "Approx 5% complete for SRR3900953_1.fastq.gz\n",
            "Approx 10% complete for SRR3900953_1.fastq.gz\n",
            "Approx 15% complete for SRR3900953_1.fastq.gz\n",
            "Approx 20% complete for SRR3900953_1.fastq.gz\n",
            "Approx 25% complete for SRR3900953_1.fastq.gz\n",
            "Approx 30% complete for SRR3900953_1.fastq.gz\n",
            "Approx 35% complete for SRR3900953_1.fastq.gz\n",
            "Approx 40% complete for SRR3900953_1.fastq.gz\n",
            "Approx 45% complete for SRR3900953_1.fastq.gz\n",
            "Approx 50% complete for SRR3900953_1.fastq.gz\n",
            "Approx 55% complete for SRR3900953_1.fastq.gz\n",
            "Approx 60% complete for SRR3900953_1.fastq.gz\n",
            "Approx 65% complete for SRR3900953_1.fastq.gz\n",
            "Approx 70% complete for SRR3900953_1.fastq.gz\n",
            "Approx 75% complete for SRR3900953_1.fastq.gz\n",
            "Approx 80% complete for SRR3900953_1.fastq.gz\n",
            "Approx 85% complete for SRR3900953_1.fastq.gz\n",
            "Approx 90% complete for SRR3900953_1.fastq.gz\n",
            "Approx 95% complete for SRR3900953_1.fastq.gz\n",
            "Analysis complete for SRR3900953_1.fastq.gz\n",
            "Started analysis of SRR3900953_2.fastq.gz\n",
            "Approx 5% complete for SRR3900953_2.fastq.gz\n",
            "Approx 10% complete for SRR3900953_2.fastq.gz\n",
            "Approx 15% complete for SRR3900953_2.fastq.gz\n",
            "Approx 20% complete for SRR3900953_2.fastq.gz\n",
            "Approx 25% complete for SRR3900953_2.fastq.gz\n",
            "Approx 30% complete for SRR3900953_2.fastq.gz\n",
            "Approx 35% complete for SRR3900953_2.fastq.gz\n",
            "Approx 40% complete for SRR3900953_2.fastq.gz\n",
            "Approx 45% complete for SRR3900953_2.fastq.gz\n",
            "Approx 50% complete for SRR3900953_2.fastq.gz\n",
            "Approx 55% complete for SRR3900953_2.fastq.gz\n",
            "Approx 60% complete for SRR3900953_2.fastq.gz\n",
            "Approx 65% complete for SRR3900953_2.fastq.gz\n",
            "Approx 70% complete for SRR3900953_2.fastq.gz\n",
            "Approx 75% complete for SRR3900953_2.fastq.gz\n",
            "Approx 80% complete for SRR3900953_2.fastq.gz\n",
            "Approx 85% complete for SRR3900953_2.fastq.gz\n",
            "Approx 90% complete for SRR3900953_2.fastq.gz\n",
            "Approx 95% complete for SRR3900953_2.fastq.gz\n",
            "Analysis complete for SRR3900953_2.fastq.gz\n"
          ]
        }
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "### MultiQC\n",
        "\n",
        "Now let's install the MultiQC program. It is necessary in order to combine several different reports into one. Let's run it, giving the path to the FastQC reports directory, and look at the .html report that will be obtained as a result of the launch."
      ],
      "metadata": {
        "id": "fk-7OOxP_BHC"
      }
    },
    {
      "cell_type": "code",
      "source": [
        "!pip3 install multiqc\n",
        "!multiqc qc"
      ],
      "metadata": {
        "id": "UkBWHqrJ7c-h",
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "outputId": "b7effb43-5b18-4a03-c64d-c388df8907c0"
      },
      "execution_count": null,
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "Looking in indexes: https://pypi.org/simple, https://us-python.pkg.dev/colab-wheels/public/simple/\n",
            "Collecting multiqc\n",
            "  Downloading multiqc-1.13-py3-none-any.whl (1.2 MB)\n",
            "\u001b[2K     \u001b[90m━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━\u001b[0m \u001b[32m1.2/1.2 MB\u001b[0m \u001b[31m16.7 MB/s\u001b[0m eta \u001b[36m0:00:00\u001b[0m\n",
            "\u001b[?25hRequirement already satisfied: future>0.14.0 in /usr/local/lib/python3.8/dist-packages (from multiqc) (0.16.0)\n",
            "Collecting rich>=10\n",
            "  Downloading rich-13.0.0-py3-none-any.whl (238 kB)\n",
            "\u001b[2K     \u001b[90m━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━\u001b[0m \u001b[32m238.1/238.1 KB\u001b[0m \u001b[31m23.2 MB/s\u001b[0m eta \u001b[36m0:00:00\u001b[0m\n",
            "\u001b[?25hCollecting simplejson\n",
            "  Downloading simplejson-3.18.1-cp38-cp38-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl (135 kB)\n",
            "\u001b[2K     \u001b[90m━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━\u001b[0m \u001b[32m135.5/135.5 KB\u001b[0m \u001b[31m16.9 MB/s\u001b[0m eta \u001b[36m0:00:00\u001b[0m\n",
            "\u001b[?25hRequirement already satisfied: jinja2>=2.9 in /usr/local/lib/python3.8/dist-packages (from multiqc) (2.11.3)\n",
            "Requirement already satisfied: networkx>=2.5.1 in /usr/local/lib/python3.8/dist-packages (from multiqc) (2.8.8)\n",
            "Collecting spectra>=0.0.10\n",
            "  Downloading spectra-0.0.11.tar.gz (18 kB)\n",
            "  Preparing metadata (setup.py) ... \u001b[?25l\u001b[?25hdone\n",
            "Requirement already satisfied: requests in /usr/local/lib/python3.8/dist-packages (from multiqc) (2.25.1)\n",
            "Collecting lzstring\n",
            "  Downloading lzstring-1.0.4.tar.gz (4.3 kB)\n",
            "  Preparing metadata (setup.py) ... \u001b[?25l\u001b[?25hdone\n",
            "Requirement already satisfied: markdown in /usr/local/lib/python3.8/dist-packages (from multiqc) (3.4.1)\n",
            "Requirement already satisfied: pyyaml>=4 in /usr/local/lib/python3.8/dist-packages (from multiqc) (6.0)\n",
            "Collecting rich-click\n",
            "  Downloading rich_click-1.6.0-py3-none-any.whl (19 kB)\n",
            "Collecting coloredlogs\n",
            "  Downloading coloredlogs-15.0.1-py2.py3-none-any.whl (46 kB)\n",
            "\u001b[2K     \u001b[90m━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━\u001b[0m \u001b[32m46.0/46.0 KB\u001b[0m \u001b[31m5.9 MB/s\u001b[0m eta \u001b[36m0:00:00\u001b[0m\n",
            "\u001b[?25hRequirement already satisfied: matplotlib>=2.1.1 in /usr/local/lib/python3.8/dist-packages (from multiqc) (3.2.2)\n",
            "Requirement already satisfied: numpy in /usr/local/lib/python3.8/dist-packages (from multiqc) (1.21.6)\n",
            "Requirement already satisfied: click in /usr/local/lib/python3.8/dist-packages (from multiqc) (7.1.2)\n",
            "Requirement already satisfied: MarkupSafe>=0.23 in /usr/local/lib/python3.8/dist-packages (from jinja2>=2.9->multiqc) (2.0.1)\n",
            "Requirement already satisfied: cycler>=0.10 in /usr/local/lib/python3.8/dist-packages (from matplotlib>=2.1.1->multiqc) (0.11.0)\n",
            "Requirement already satisfied: python-dateutil>=2.1 in /usr/local/lib/python3.8/dist-packages (from matplotlib>=2.1.1->multiqc) (2.8.2)\n",
            "Requirement already satisfied: kiwisolver>=1.0.1 in /usr/local/lib/python3.8/dist-packages (from matplotlib>=2.1.1->multiqc) (1.4.4)\n",
            "Requirement already satisfied: pyparsing!=2.0.4,!=2.1.2,!=2.1.6,>=2.0.1 in /usr/local/lib/python3.8/dist-packages (from matplotlib>=2.1.1->multiqc) (3.0.9)\n",
            "Requirement already satisfied: pygments<3.0.0,>=2.6.0 in /usr/local/lib/python3.8/dist-packages (from rich>=10->multiqc) (2.6.1)\n",
            "Requirement already satisfied: typing-extensions<5.0,>=4.0.0 in /usr/local/lib/python3.8/dist-packages (from rich>=10->multiqc) (4.4.0)\n",
            "Collecting commonmark<0.10.0,>=0.9.0\n",
            "  Downloading commonmark-0.9.1-py2.py3-none-any.whl (51 kB)\n",
            "\u001b[2K     \u001b[90m━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━\u001b[0m \u001b[32m51.1/51.1 KB\u001b[0m \u001b[31m7.0 MB/s\u001b[0m eta \u001b[36m0:00:00\u001b[0m\n",
            "\u001b[?25hCollecting colormath>=3.0.0\n",
            "  Downloading colormath-3.0.0.tar.gz (39 kB)\n",
            "  Preparing metadata (setup.py) ... \u001b[?25l\u001b[?25hdone\n",
            "Collecting humanfriendly>=9.1\n",
            "  Downloading humanfriendly-10.0-py2.py3-none-any.whl (86 kB)\n",
            "\u001b[2K     \u001b[90m━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━\u001b[0m \u001b[32m86.8/86.8 KB\u001b[0m \u001b[31m9.0 MB/s\u001b[0m eta \u001b[36m0:00:00\u001b[0m\n",
            "\u001b[?25hRequirement already satisfied: importlib-metadata>=4.4 in /usr/local/lib/python3.8/dist-packages (from markdown->multiqc) (5.2.0)\n",
            "Requirement already satisfied: certifi>=2017.4.17 in /usr/local/lib/python3.8/dist-packages (from requests->multiqc) (2022.12.7)\n",
            "Requirement already satisfied: idna<3,>=2.5 in /usr/local/lib/python3.8/dist-packages (from requests->multiqc) (2.10)\n",
            "Requirement already satisfied: chardet<5,>=3.0.2 in /usr/local/lib/python3.8/dist-packages (from requests->multiqc) (4.0.0)\n",
            "Requirement already satisfied: urllib3<1.27,>=1.21.1 in /usr/local/lib/python3.8/dist-packages (from requests->multiqc) (1.24.3)\n",
            "Requirement already satisfied: zipp>=0.5 in /usr/local/lib/python3.8/dist-packages (from importlib-metadata>=4.4->markdown->multiqc) (3.11.0)\n",
            "Requirement already satisfied: six>=1.5 in /usr/local/lib/python3.8/dist-packages (from python-dateutil>=2.1->matplotlib>=2.1.1->multiqc) (1.15.0)\n",
            "Building wheels for collected packages: spectra, lzstring, colormath\n",
            "  Building wheel for spectra (setup.py) ... \u001b[?25l\u001b[?25hdone\n",
            "  Created wheel for spectra: filename=spectra-0.0.11-py3-none-any.whl size=17487 sha256=2128c0b05cc71034b03371f1fdf1939592dadbcf37191d8c33893fede894963a\n",
            "  Stored in directory: /root/.cache/pip/wheels/60/48/fd/b818cd482a8c66aab4e846999079cb79a91a199b667656c7db\n",
            "  Building wheel for lzstring (setup.py) ... \u001b[?25l\u001b[?25hdone\n",
            "  Created wheel for lzstring: filename=lzstring-1.0.4-py2.py3-none-any.whl size=4590 sha256=997beac577c13a9233ea031d504769842a7af9c61cbdc43edd4e83e57bd9d6c0\n",
            "  Stored in directory: /root/.cache/pip/wheels/c7/13/56/ea14e410b3ba3d95b95b4672ebfa51a81f28783b4b57ae02fd\n",
            "  Building wheel for colormath (setup.py) ... \u001b[?25l\u001b[?25hdone\n",
            "  Created wheel for colormath: filename=colormath-3.0.0-py3-none-any.whl size=39408 sha256=97a56caf2fa27c090badc57e029b6c76b15099e542ff4680fdc05b5250a45aab\n",
            "  Stored in directory: /root/.cache/pip/wheels/8b/74/a8/df86fd600a6c68547019383b14765e2213085feb1a2fbf0db1\n",
            "Successfully built spectra lzstring colormath\n",
            "Installing collected packages: commonmark, simplejson, rich, lzstring, humanfriendly, colormath, spectra, rich-click, coloredlogs, multiqc\n",
            "Successfully installed coloredlogs-15.0.1 colormath-3.0.0 commonmark-0.9.1 humanfriendly-10.0 lzstring-1.0.4 multiqc-1.13 rich-13.0.0 rich-click-1.6.0 simplejson-3.18.1 spectra-0.0.11\n",
            "\n",
            "  \u001b[34m/\u001b[0m\u001b[32m/\u001b[0m\u001b[31m/\u001b[0m \u001b]8;id=681206;https://multiqc.info\u001b\\\u001b[1mMultiQC\u001b[0m\u001b]8;;\u001b\\ 🔍 \u001b[2m| v1.13\u001b[0m\n",
            "\n",
            "\u001b[34m|           multiqc\u001b[0m | Search path : /content/qc\n",
            "\u001b[2K\u001b[34m|\u001b[0m         \u001b[34msearching\u001b[0m | \u001b[90m━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━\u001b[0m \u001b[35m100%\u001b[0m \u001b[32m4/4\u001b[0m  \n",
            "\u001b[?25h\u001b[34m|            fastqc\u001b[0m | Found 2 reports\n",
            "\u001b[34m|           multiqc\u001b[0m | Compressing plot data\n",
            "\u001b[34m|           multiqc\u001b[0m | Report      : multiqc_report.html\n",
            "\u001b[34m|           multiqc\u001b[0m | Data        : multiqc_data\n",
            "\u001b[34m|           multiqc\u001b[0m | MultiQC complete\n"
          ]
        }
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "\n",
        "After that, you can download the .html quality report to your computer and see if everything is fine with the reads. Consider each item of the report and possible problems in the analysis bulk RNA-Seq:\n",
        "1. Sequence Quality Histograms\n",
        "2. Per Sequence Quality Scores\n",
        "3. <b>Per Base Sequence Content</b>\n",
        "4. Per Sequence GC Content\n",
        "5. Per Base N Content\n",
        "6. Sequence Length Distribution\n",
        "7. <b>Sequence Duplication Levels</b> &mdash;(<a href=\"https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/3%20Analysis%20Modules/8%20Duplicate%20Sequences.html\" target=\"_blank\">source</a>)\n",
        "8. <b>Overrepresented sequences</b> &mdash; (<a href=\"https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/3%20Analysis%20Modules/9%20Overrepresented%20Sequences.html\" target=\"_blank\">source</a>)\n",
        "9. <b>Adapter Content</b> &mdash; we see that we have technical adapters in a large number of readings. However, almost all modern algorithms for working with RNA-Seq (including both kallisto and STAR) automatically deal with this problem, so manual elimination is not required.(<a href=\"https://dnatech.genomecenter.ucdavis.edu/faqs/when-should-i-trim-my-illumina-reads-and-how-should-i-do-it/\" target=\"_blank\">about when and why it is better to cut adapters</a>)"
      ],
      "metadata": {
        "id": "nc-9yOg9AoUW"
      }
    },
    {
      "cell_type": "markdown",
      "source": [
        "## Nexflow\n",
        "NextFlow &mdash; it's a special language that allows you to run entire pipelines of several sequentially executed programs, making sure that each stage is executed exactly one by one."
      ],
      "metadata": {
        "id": "d3uy3diIOves"
      }
    },
    {
      "cell_type": "code",
      "source": [
        "!curl -fsSL https://get.nextflow.io | bash"
      ],
      "metadata": {
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "id": "CXTGOLCzO27n",
        "outputId": "61768de2-b3c9-4aab-edb1-819c63208290"
      },
      "execution_count": null,
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "\u001b[K\n",
            "      N E X T F L O W\n",
            "      version 22.10.4 build 5836\n",
            "      created 09-12-2022 09:58 UTC \n",
            "      cite doi:10.1038/nbt.3820\n",
            "      http://nextflow.io\n",
            "\n",
            "\n",
            "Nextflow installation completed. Please note:\n",
            "- the executable file `nextflow` has been created in the folder: /content\n",
            "- you may complete the installation by moving it to a directory in your $PATH\n",
            "\n"
          ]
        }
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "Now let's create a file <code>my_pipeline.nf</code> with the following content:\n",
        "```\n",
        "params.SRA = \"SRR000000\"\n",
        "params.results_dir = \"results/\"\n",
        "\n",
        "log.info \"\"\n",
        "log.info \"  Q U A L I T Y   C O N T R O L  \"\n",
        "log.info \"=================================\"\n",
        "log.info \"SRA number         : ${params.SRA}\"\n",
        "log.info \"Results location   : ${params.results_dir}\"\n",
        "```"
      ],
      "metadata": {
        "id": "rFMYCNXkHh8g"
      }
    },
    {
      "cell_type": "code",
      "source": [
        "!./nextflow run --SRA SRR3900953_1.fastq my_pipeline.nf"
      ],
      "metadata": {
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "id": "OxLuSZbYPETe",
        "outputId": "b62e55a1-3f94-4d18-e71a-33776be83186"
      },
      "execution_count": null,
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "N E X T F L O W  ~  version 22.10.4\n",
            "Launching `my_pipeline.nf` [berserk_noyce] DSL2 - revision: 60ff6d6c5b\n",
            "\n",
            "  Q U A L I T Y   C O N T R O L  \n",
            "=================================\n",
            "SRA number         : SRR3900953_1.fastq\n",
            "Results location   : results/\n"
          ]
        }
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "Now we modify our file so that it executes some process. For example, loading reads by SRA identifier:\n",
        "```\n",
        "params.SRA = \"SRR000000\"\n",
        "params.results_dir = \"results/\"\n",
        "\n",
        "log.info \"\"\n",
        "log.info \"  Q U A L I T Y   C O N T R O L  \"\n",
        "log.info \"=================================\"\n",
        "log.info \"SRA number         : ${params.SRA}\"\n",
        "log.info \"Results location   : ${params.results_dir}\"\n",
        "\n",
        "process DownloadFastQ {\n",
        "  publishDir \"${params.results_dir}\"\n",
        "\n",
        "  output:\n",
        "    path \"reads/*\"\n",
        "\n",
        "  script:\n",
        "    \"\"\"\n",
        "    /content/sratoolkit.3.0.0-ubuntu64/bin/fasterq-dump ${params.SRA} -O reads/\n",
        "    \"\"\"\n",
        "}\n",
        "\n",
        "workflow {\n",
        "  DownloadFastQ()\n",
        "}\n",
        "```\n",
        "\n"
      ],
      "metadata": {
        "id": "QWaeDHkYLtJp"
      }
    },
    {
      "cell_type": "code",
      "source": [
        "!./nextflow run my_pipeline.nf --SRA SRR3900953"
      ],
      "metadata": {
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "id": "_iyupT1xNR46",
        "outputId": "c4a54d5a-cf6d-4b8a-a3a0-9f55b66113b4"
      },
      "execution_count": null,
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "N E X T F L O W  ~  version 22.10.4\n",
            "Launching `my_pipeline.nf` [naughty_jepsen] DSL2 - revision: 6d5b910d64\n",
            "\n",
            "  Q U A L I T Y   C O N T R O L  \n",
            "=================================\n",
            "SRA number         : SRR3900953\n",
            "Results location   : results/\n",
            "[-        ] process > DownloadFastQ -\u001b[K\n",
            "\u001b[2A\n",
            "[-        ] process > DownloadFastQ -\u001b[K\n",
            "[-        ] process > QC            -\u001b[K\n",
            "[-        ] process > MultiQC       -\u001b[K\n",
            "\u001b[4A\n",
            "executor >  local (1)\u001b[K\n",
            "[63/c78e3c] process > DownloadFastQ [  0%] 0 of 1\u001b[K\n",
            "[-        ] process > QC            -\u001b[K\n",
            "[-        ] process > MultiQC       -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (1)\u001b[K\n",
            "[63/c78e3c] process > DownloadFastQ [  0%] 0 of 1\u001b[K\n",
            "[-        ] process > QC            -\u001b[K\n",
            "[-        ] process > MultiQC       -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (2)\u001b[K\n",
            "[63/c78e3c] process > DownloadFastQ [100%] 1 of 1 ✔\u001b[K\n",
            "[ee/3ba88a] process > QC            [  0%] 0 of 1\u001b[K\n",
            "[-        ] process > MultiQC       -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (3)\u001b[K\n",
            "[63/c78e3c] process > DownloadFastQ [100%] 1 of 1 ✔\u001b[K\n",
            "[ee/3ba88a] process > QC            [100%] 1 of 1 ✔\u001b[K\n",
            "[2e/84a0a8] process > MultiQC       [  0%] 0 of 1\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (3)\u001b[K\n",
            "[63/c78e3c] process > DownloadFastQ [100%] 1 of 1 ✔\u001b[K\n",
            "[ee/3ba88a] process > QC            [100%] 1 of 1 ✔\u001b[K\n",
            "[2e/84a0a8] process > MultiQC       [  0%] 0 of 1\u001b[K\n",
            "\u001b[31mError executing process > 'MultiQC'\u001b[K\n",
            "\u001b[K\n",
            "Caused by:\u001b[K\n",
            "  Missing output file(s) `multiqc_rep.html` expected by process `MultiQC`\u001b[K\n",
            "\u001b[K\n",
            "Command executed:\u001b[K\n",
            "\u001b[K\n",
            "  mkdir qc\u001b[K\n",
            "  multiqc SRR3900953_1_fastqc.html SRR3900953_1_fastqc.zip SRR3900953_2_fastqc.html SRR3900953_2_fastqc.zip\u001b[K\n",
            "\u001b[K\n",
            "Command exit status:\u001b[K\n",
            "  0\u001b[K\n",
            "\u001b[K\n",
            "Command output:\u001b[K\n",
            "  (empty)\u001b[K\n",
            "\u001b[K\n",
            "Command error:\u001b[K\n",
            "  \u001b[K\n",
            "    /// MultiQC 🔍 | v1.13\u001b[K\n",
            "  \u001b[K\n",
            "  |           multiqc | Search path : SRR3900953_1_fastqc.html\u001b[K\n",
            "  |           multiqc | Search path : SRR3900953_1_fastqc.zip\u001b[K\n",
            "  |           multiqc | Search path : SRR3900953_2_fastqc.html\u001b[K\n",
            "  |           multiqc | Search path : SRR3900953_2_fastqc.zip\u001b[K\n",
            "  |         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 4/4  \u001b[K\n",
            "  |            fastqc | Found 2 reports\u001b[K\n",
            "  |           multiqc | Compressing plot data\u001b[K\n",
            "  |           multiqc | Report      : multiqc_report.html\u001b[K\n",
            "  |           multiqc | Data        : multiqc_data\u001b[K\n",
            "  |           multiqc | MultiQC complete\u001b[K\n",
            "\u001b[K\n",
            "Work dir:\u001b[K\n",
            "  /content/work/2e/84a0a8976a31b68a5fbaff924faa3f\u001b[K\n",
            "\u001b[K\n",
            "Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named `.command.sh`\u001b[K\n",
            "\u001b[K\n",
            "\u001b[39m\u001b[K\n",
            "\u001b[42A\n",
            "executor >  local (3)\u001b[K\n",
            "[63/c78e3c] process > DownloadFastQ [100%] 1 of 1 ✔\u001b[K\n",
            "[ee/3ba88a] process > QC            [100%] 1 of 1 ✔\u001b[K\n",
            "[2e/84a0a8] process > MultiQC       [100%] 1 of 1, failed: 1 ✘\u001b[K\n",
            "\u001b[31mError executing process > 'MultiQC'\u001b[K\n",
            "\u001b[K\n",
            "Caused by:\u001b[K\n",
            "  Missing output file(s) `multiqc_rep.html` expected by process `MultiQC`\u001b[K\n",
            "\u001b[K\n",
            "Command executed:\u001b[K\n",
            "\u001b[K\n",
            "  mkdir qc\u001b[K\n",
            "  multiqc SRR3900953_1_fastqc.html SRR3900953_1_fastqc.zip SRR3900953_2_fastqc.html SRR3900953_2_fastqc.zip\u001b[K\n",
            "\u001b[K\n",
            "Command exit status:\u001b[K\n",
            "  0\u001b[K\n",
            "\u001b[K\n",
            "Command output:\u001b[K\n",
            "  (empty)\u001b[K\n",
            "\u001b[K\n",
            "Command error:\u001b[K\n",
            "  \u001b[K\n",
            "    /// MultiQC 🔍 | v1.13\u001b[K\n",
            "  \u001b[K\n",
            "  |           multiqc | Search path : SRR3900953_1_fastqc.html\u001b[K\n",
            "  |           multiqc | Search path : SRR3900953_1_fastqc.zip\u001b[K\n",
            "  |           multiqc | Search path : SRR3900953_2_fastqc.html\u001b[K\n",
            "  |           multiqc | Search path : SRR3900953_2_fastqc.zip\u001b[K\n",
            "  |         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 4/4  \u001b[K\n",
            "  |            fastqc | Found 2 reports\u001b[K\n",
            "  |           multiqc | Compressing plot data\u001b[K\n",
            "  |           multiqc | Report      : multiqc_report.html\u001b[K\n",
            "  |           multiqc | Data        : multiqc_data\u001b[K\n",
            "  |           multiqc | MultiQC complete\u001b[K\n",
            "\u001b[K\n",
            "Work dir:\u001b[K\n",
            "  /content/work/2e/84a0a8976a31b68a5fbaff924faa3f\u001b[K\n",
            "\u001b[K\n",
            "Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named `.command.sh`\u001b[K\n",
            "\u001b[K\n",
            "\u001b[39m\u001b[K\n",
            "\n"
          ]
        }
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "In order to ensure the parallel launch of several processes at once by the same pipeline, it is necessary to parse the argument that we supply to the <code>SRA</code> variable as a list, and then run our slightly modified pipeline:\n",
        "```\n",
        "params.results_dir = \"results/\"\n",
        "SRA_list = params.SRA.split(\",\")\n",
        "\n",
        "log.info \"\"\n",
        "log.info \"  Q U A L I T Y   C O N T R O L  \"\n",
        "log.info \"=================================\"\n",
        "log.info \"SRA number         : ${SRA_list}\"\n",
        "log.info \"Results location   : ${params.results_dir}\"\n",
        "\n",
        "process DownloadFastQ {\n",
        "  publishDir \"${params.results_dir}\"\n",
        "\n",
        "  input:\n",
        "    val sra\n",
        "\n",
        "  output:\n",
        "    path \"${sra}/*\"\n",
        "\n",
        "  script:\n",
        "    \"\"\"\n",
        "    /content/sratoolkit.3.0.0-ubuntu64/bin/fasterq-dump ${sra} -O ${sra}/\n",
        "    \"\"\"\n",
        "}\n",
        "\n",
        "process QC {\n",
        "  input:\n",
        "    path x\n",
        "\n",
        "  output:\n",
        "    path \"qc/*\"\n",
        "\n",
        "  script:\n",
        "    \"\"\"\n",
        "    mkdir qc\n",
        "    /content/FastQC/fastqc -o qc $x\n",
        "    \"\"\"\n",
        "}\n",
        "\n",
        "process MultiQC {\n",
        "  publishDir \"${params.results_dir}\"\n",
        "\n",
        "  input:\n",
        "    path x\n",
        "\n",
        "  output:\n",
        "    path \"multiqc_report.html\"\n",
        "\n",
        "  script:\n",
        "    \"\"\"\n",
        "    multiqc $x\n",
        "    \"\"\"\n",
        "}\n",
        "\n",
        "workflow {\n",
        "  data = Channel.of( SRA_list )\n",
        "  DownloadFastQ(data)\n",
        "  QC( DownloadFastQ.out )\n",
        "  MultiQC( QC.out.collect() )\n",
        "}\n",
        "```\n",
        "For example, let's take the results of sequencing of the post-COVID intestinal metagenome (`SRR20851170`, `SRR20851171`, `SRR20851172`, `SRR20851173`, `SRR20851174`, `SRR20851176`, `SRR20851179`, `SRR20851183`)."
      ],
      "metadata": {
        "id": "2lsLkuZmGJ_0"
      }
    },
    {
      "cell_type": "code",
      "source": [
        "!./nextflow run my_pipeline.nf -with-report nextflow_report.html -with-dag flowchart.pdf --SRA SRR20851170,SRR20851171,SRR20851172,SRR20851173,SRR20851174,SRR20851176,SRR20851179,SRR20851183"
      ],
      "metadata": {
        "colab": {
          "base_uri": "https://localhost:8080/"
        },
        "id": "AAhMSuxpK-Ux",
        "outputId": "ea0d4e8b-85f9-4d34-a261-b1f4ee67c77d"
      },
      "execution_count": null,
      "outputs": [
        {
          "output_type": "stream",
          "name": "stdout",
          "text": [
            "N E X T F L O W  ~  version 22.04.5\n",
            "Launching `my_pipeline.nf` [distraught_pare] DSL2 - revision: 3c0f26639b\n",
            "\n",
            "  Q U A L I T Y   C O N T R O L  \n",
            "=================================\n",
            "SRA number         : [SRR20851170, SRR20851171, SRR20851172, SRR20851173, SRR20851174, SRR20851176, SRR20851179, SRR20851183]\n",
            "Results location   : results/\n",
            "[-        ] process > DownloadFastQ -\u001b[K\n",
            "[-        ] process > QC            -\u001b[K\n",
            "[-        ] process > MultiQC       -\u001b[K\n",
            "\u001b[4A\n",
            "[-        ] process > DownloadFastQ [  0%] 0 of 4\u001b[K\n",
            "[-        ] process > QC            -\u001b[K\n",
            "[-        ] process > MultiQC       -\u001b[K\n",
            "\u001b[4A\n",
            "executor >  local (2)\u001b[K\n",
            "[60/3dee7e] process > DownloadFastQ (2) [  0%] 0 of 8\u001b[K\n",
            "[-        ] process > QC                -\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (3)\u001b[K\n",
            "[33/06c5b6] process > DownloadFastQ (3) [  0%] 0 of 8\u001b[K\n",
            "[-        ] process > QC                -\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (3)\u001b[K\n",
            "[04/e0405d] process > DownloadFastQ (1) [ 12%] 1 of 8\u001b[K\n",
            "[-        ] process > QC                [  0%] 0 of 1\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (3)\u001b[K\n",
            "[04/e0405d] process > DownloadFastQ (1) [ 12%] 1 of 8\u001b[K\n",
            "[-        ] process > QC                [  0%] 0 of 1\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (4)\u001b[K\n",
            "[05/01a4cd] process > DownloadFastQ (5) [ 25%] 2 of 8\u001b[K\n",
            "[-        ] process > QC                [  0%] 0 of 2\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (4)\u001b[K\n",
            "[05/01a4cd] process > DownloadFastQ (5) [ 25%] 2 of 8\u001b[K\n",
            "[-        ] process > QC                [  0%] 0 of 2\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (5)\u001b[K\n",
            "[b8/91218b] process > DownloadFastQ (4) [ 37%] 3 of 8\u001b[K\n",
            "[-        ] process > QC                [  0%] 0 of 3\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (5)\u001b[K\n",
            "[b8/91218b] process > DownloadFastQ (4) [ 37%] 3 of 8\u001b[K\n",
            "[-        ] process > QC                [  0%] 0 of 3\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (6)\u001b[K\n",
            "[b2/41eee0] process > DownloadFastQ (6) [ 50%] 4 of 8\u001b[K\n",
            "[-        ] process > QC                [  0%] 0 of 4\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (6)\u001b[K\n",
            "[b2/41eee0] process > DownloadFastQ (6) [ 50%] 4 of 8\u001b[K\n",
            "[-        ] process > QC                [  0%] 0 of 4\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (8)\u001b[K\n",
            "[b2/41eee0] process > DownloadFastQ (6) [ 75%] 6 of 8\u001b[K\n",
            "[-        ] process > QC                [  0%] 0 of 6\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (9)\u001b[K\n",
            "[d7/70ced9] process > DownloadFastQ (7) [ 87%] 7 of 8\u001b[K\n",
            "[30/9f1128] process > QC (1)            [  0%] 0 of 7\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (10)\u001b[K\n",
            "[d7/70ced9] process > DownloadFastQ (7) [ 87%] 7 of 8 ✔\u001b[K\n",
            "[ce/f755da] process > QC (2)            [  0%] 0 of 7\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (10)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[ce/f755da] process > QC (2)            [  0%] 0 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (11)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[7b/97dd2c] process > QC (3)            [ 12%] 1 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (12)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[af/c278d0] process > QC (4)            [ 25%] 2 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (12)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[af/c278d0] process > QC (4)            [ 25%] 2 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (13)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[5a/dc865b] process > QC (5)            [ 37%] 3 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (14)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[6e/7346a6] process > QC (6)            [ 50%] 4 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (14)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[18/daa835] process > QC (7)            [ 62%] 5 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (15)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[18/daa835] process > QC (7)            [ 62%] 5 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (16)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[7b/6176bb] process > QC (8)            [ 75%] 6 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (16)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[18/daa835] process > QC (7)            [ 87%] 7 of 8\u001b[K\n",
            "[-        ] process > MultiQC           -\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (17)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[7b/6176bb] process > QC (8)            [100%] 8 of 8 ✔\u001b[K\n",
            "[aa/cb8a28] process > MultiQC           [  0%] 0 of 1\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (17)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[7b/6176bb] process > QC (8)            [100%] 8 of 8 ✔\u001b[K\n",
            "[aa/cb8a28] process > MultiQC           [100%] 1 of 1 ✔\u001b[K\n",
            "\u001b[5A\n",
            "executor >  local (17)\u001b[K\n",
            "[d2/e8b217] process > DownloadFastQ (8) [100%] 8 of 8 ✔\u001b[K\n",
            "[7b/6176bb] process > QC (8)            [100%] 8 of 8 ✔\u001b[K\n",
            "[aa/cb8a28] process > MultiQC           [100%] 1 of 1 ✔\u001b[K\n",
            "\u001b[32;1mCompleted at: 09-Sep-2022 17:59:16\n",
            "Duration    : 2m 24s\n",
            "CPU hours   : 0.1\n",
            "Succeeded   : 17\n",
            "\u001b[22;39m\u001b[K\n",
            "\n"
          ]
        }
      ]
    },
    {
      "cell_type": "markdown",
      "source": [
        "## Kallisto\n",
        "\n",
        "kallisto is a program for quantifying abundances of transcripts from bulk and single-cell RNA-Seq data, or more generally of target sequences using high-throughput sequencing reads. It is based on the novel idea of pseudoalignment for rapidly determining the compatibility of reads with targets, without the need for alignment. \n",
        "[Source](https://pachterlab.github.io/kallisto/about)\n",
        "\n",
        "Let's add a mapping step using Callisto to our pipeline\n",
        "\n",
        "\n",
        "\n",
        "```\n",
        "params.results_dir = \"results/\"\n",
        "params.transcriptome = \"transcriptome/GRCh38_latest_rna.fna\"\n",
        "params.name          = \"RNA-Seq Analysis\"\n",
        "params.reads         = \"results/{SRA_list}/*.fastq\"\n",
        "params.fragment_len  = '180'\n",
        "params.fragment_sd   = '20'\n",
        "params.bootstrap     = '100'\n",
        "\n",
        "params.output        = \"results/\"\n",
        "SRA_list = params.SRA.split(\",\")\n",
        "\n",
        "transcriptome_file     = file(params.transcriptome)\n",
        "\n",
        "\n",
        "log.info \"\"\n",
        "log.info \"  Q U A L I T Y   C O N T R O L  \"\n",
        "log.info \"=================================\"\n",
        "log.info \"SRA number         : ${SRA_list}\"\n",
        "log.info \"Results location   : ${params.results_dir}\"\n",
        "log.info \"Ref seq location   : ${params.transcriptome}\"\n",
        "\n",
        "process DownloadFastQ {\n",
        "  publishDir \"${params.results_dir}\"\n",
        "\n",
        "  input:\n",
        "    val sra\n",
        "\n",
        "  output:\n",
        "    path \"${sra}/*\"\n",
        "\n",
        "  script:\n",
        "    \"\"\"\n",
        "    /content/sratoolkit.3.0.0-ubuntu64/bin/fasterq-dump ${sra} -O ${sra}/\n",
        "    \"\"\"\n",
        "}\n",
        "\n",
        "process QC {\n",
        "  input:\n",
        "    path x\n",
        "\n",
        "  output:\n",
        "    path \"qc/*\"\n",
        "\n",
        "  script:\n",
        "    \"\"\"\n",
        "    mkdir qc\n",
        "    /content/FastQC/fastqc -o qc $x\n",
        "    \"\"\"\n",
        "}\n",
        "\n",
        "process MultiQC {\n",
        "  publishDir \"${params.results_dir}\"\n",
        "\n",
        "  input:\n",
        "    path x\n",
        "\n",
        "  output:\n",
        "    path \"multiqc_report.html\"\n",
        "\n",
        "  script:\n",
        "    \"\"\"\n",
        "    multiqc $x\n",
        "    \"\"\"\n",
        "}\n",
        "\n",
        "process index {\n",
        "    input:\n",
        "    file transcriptome_file\n",
        "\n",
        "    output:\n",
        "    file \"transcriptome.index\" into transcriptome_index\n",
        "\n",
        "    script:\n",
        "    //\n",
        "    // Kallisto tools mapper index\n",
        "    //\n",
        "    \"\"\"\n",
        "    kallisto index -i transcriptome.index ${transcriptome_file}\n",
        "    \"\"\"\n",
        "}\n",
        "\n",
        "workflow {\n",
        "  data = Channel.of( SRA_list )\n",
        "  DownloadFastQ(data)\n",
        "  QC( DownloadFastQ.out )\n",
        "  MultiQC( QC.out.collect() )\n",
        "  Kaliso indexing(data)\n",
        "}\n",
        "\n",
        "```\n",
        "\n"
      ],
      "metadata": {
        "id": "BM7jNO_nVhxh"
      }
    }
  ],
  "metadata": {
    "colab": {
      "provenance": [],
      "include_colab_link": true
    },
    "kernelspec": {
      "display_name": "Python 3",
      "name": "python3"
    },
    "language_info": {
      "name": "python"
    }
  },
  "nbformat": 4,
  "nbformat_minor": 0
}