updated changelogs

broadinstitute · Oct 23, 2024 · 7a34d28 · 7a34d28
1 parent e2a5a64
commit 7a34d28
Show file tree

Hide file tree

Showing 8 changed files with 34 additions and 5 deletions.
diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md
@@ -1,3 +1,10 @@
+# 2.4.0
+2024-10-23 (Date of Last Commit)
+
+* Added a new input parameter for atac_expected_cells, which describes the numnber of cells used for the library preparation
+* Updated the ATAC library CSV to be consistent in file naming convention and to have similar case for metric names to the Optimus workflow library CSV
+
+
 # 2.3.2
 2024-10-18 (Date of Last Commit)
 

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
@@ -49,7 +49,7 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "2.3.2"
+  String pipeline_version = "2.4.0"
 
   # Determine docker prefix based on cloud provider
   String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"

diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md
@@ -1,3 +1,9 @@
+# 5.8.0
+2024-10-23 (Date of Last Commit)
+
+* Updated the workflow to include a new expected_cells input parameter describing the number of cells used as input to the library preparation; this is passed to both the ATAC workflows and Optimus workflows and the default is set to 3000 cells
+* Updated the ATAC library CSV and the Gene Expression library CSV to be consistent in file naming convention and to have similar case for metric names
+
 # 5.7.1
 2024-10-18 (Date of Last Commit)
 

diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
@@ -9,7 +9,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow Multiome {
 
-    String pipeline_version = "5.7.1"
+    String pipeline_version = "5.8.0"
 
 
     input {

diff --git a/pipelines/skylab/optimus/Optimus.changelog.md b/pipelines/skylab/optimus/Optimus.changelog.md
@@ -1,3 +1,10 @@
+# 7.8.0
+2024-10-23 (Date of Last Commit)
+
+* Renamed the input expected_cells to gex_expected_cells
+* Updated gex_expected_cells to a required output
+* Reformatted the library CSV output filename to remove an extra gex
+
 # 7.7.0
 2024-09-24 (Date of Last Commit)
 
@@ -6,6 +13,7 @@
 
 # 7.6.1
 2024-09-11 (Date of Last Commit)
+
 * Updated warp-tools docker which added create_h5ad_snss2.py to the docker image. This change does not affect the Optimus pipeline
 
 # 7.6.0

diff --git a/pipelines/skylab/optimus/Optimus.wdl b/pipelines/skylab/optimus/Optimus.wdl
@@ -71,7 +71,7 @@ workflow Optimus {
   # version of this pipeline
 
 
-  String pipeline_version = "7.7.0"
+  String pipeline_version = "7.8.0"
 
 
   # this is used to scatter matched [r1_fastq, r2_fastq, i1_fastq] arrays

diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md
@@ -1,15 +1,23 @@
+# 1.8.0
+2024-10-23 (Date of Last Commit)
+
+* Updated the workflow to include a new expected_cells input parameter describing the number of cells used as input to the library preparation; this is passed to both the ATAC workflows and Optimus workflows and the default is set to 3000 cells
+* Updated the ATAC library CSV and the Gene Expression library CSV to be consistent in file naming convention and to have similar case for metric names
+
 # 1.7.1
 2024-10-18 (Date of Last Commit)
 
 * Removed the underscore of the NHashID in the ATAC library metrics CSV
 
 # 1.7.0
 2024-09-24 (Date of Last Commit)
+
 * Added a python implementation of DoubletFinder to calculate doublet scores in gene expression data; percent doublets are now available as a library-level metric and individual doublet scores for cell barcodes are in the h5ad
 * Updated gene_names in the final h5ad to be unique
 
 # 1.6.1
 2024-09-11 (Date of Last Commit)
+
 * Updated warp-tools docker which added create_h5ad_snss2.py to the docker image. This change does not affect the PairedTag pipeline
 
 # 1.6.0
@@ -21,6 +29,7 @@
 2024-08-06 (Date of Last Commit)
 
 * Updated the warp-tools docker to calculate mitochondrial reads from unique reads in cell and gene metrics; these metrics are in the cell and gene metrics CSV as well as h5ad
+
 # 1.4.1
 2024-08-02 (Date of Last Commit)
 
@@ -71,7 +80,6 @@
 
 * Updated the demultiplex task so that some intermediate input names have been renamed. There is no change to the outputs.
 
-
 # 0.6.0
 2024-05-10 (Date)
 

diff --git a/pipelines/skylab/paired_tag/PairedTag.wdl b/pipelines/skylab/paired_tag/PairedTag.wdl
@@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow PairedTag {
 
-    String pipeline_version = "1.7.1"
+    String pipeline_version = "1.8.0"
 
 
     input {
-Original file line number
+Diff line change
@@ Expand Up / @@ -9,7 +9,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils @@
     workflow Multiome {
-        String pipeline_version = "5.7.1"
+        String pipeline_version = "5.8.0"
         input {
@@ Expand Down @@