Fix "alias not iterable" bug (fixes #1747)

js/bam/bamReader.js

@@ -27,7 +27,7 @@ class BamReader {
 
     async readAlignments(chr, bpStart, bpEnd) {
 
-        const chrId = await this.#getChrIdx(chr)
+        const chrId = await this.#getRefId(chr)
         const alignmentContainer = new AlignmentContainer(chr, bpStart, bpEnd, this.config)
 
         if (chrId === undefined) {
@@ -54,7 +54,7 @@ class BamReader {
         }
     }
 
-    async #getChrIdx(chr) {
+    async #getRefId(chr) {
 
         await this.getHeader()
 

js/cram/cramReader.js

@@ -29,12 +29,12 @@ class CramReader {
         this.genome = genome
 
         this.cramFile = new gmodCRAM.CramFile({
-            filehandle: new FileHandler(config.url, config),
+            filehandle: config.fileHandle ? config.fileHandle : new FileHandler(config.url, config),
             seqFetch: config.seqFetch || seqFetch.bind(this),
             checkSequenceMD5: config.checkSequenceMD5 !== undefined ? config.checkSequenceMD5 : true
         })
 
-        const indexFileHandle = new FileHandler(config.indexURL, config)
+        const indexFileHandle = config.indexFileHandle ? config.indexFileHandle : new FileHandler(config.indexURL, config)
         this.indexedCramFile = new gmodCRAM.IndexedCramFile({
             cram: this.cramFile,
             index: new gmodCRAM.CraiIndex({
@@ -85,7 +85,7 @@ class CramReader {
             this.header = {
                 indexToChr: indexToChr,
                 chrToIndex: chrToIndex,
-                chrNames: new Set(header.chrToIndex),
+                chrNames: new Set(Object.keys(chrToIndex)),
                 readGroups: readGroups
 
             }
@@ -94,23 +94,45 @@ class CramReader {
         return this.header
     }
 
-    async readAlignments(chr, bpStart, bpEnd) {
+    async #getRefId(chr) {
 
-        if (!this.chrAliasTable.has(chr)) {
-            const chromosome = this.genome.getChromosome(chr)
-            if (chromosome) {
-                const aliases = chromosome.altNames
-                for (let a of aliases) {
-                    if (this.chrNames.has(a)) {
-                        this.chrAliasTable.set(chr, a)
-                    }
+        await this.getHeader()
+
+        if (this.chrAliasTable.has(chr)) {
+            chr = this.chrAliasTable.get(chr)
+            if (chr === undefined) {
+                return undefined
+            }
+        }
+
+        let refId = this.header.chrToIndex[chr]
+
+        // Try alias
+        if (refId === undefined) {
+            const aliasRecord = await this.genome.getAliasRecord(chr)
+            let alias
+            if (aliasRecord) {
+                const aliases = Object.keys(aliasRecord)
+                    .filter(k => k !== "start" && k !== "end")
+                    .map(k => aliasRecord[k])
+                    .filter(a => undefined !== this.header.chrToIndex[a])
+                if (aliases.length > 0) {
+                    alias = aliases[0]
+                    refId = this.header.chrToIndex[aliases[0]]
                 }
             }
+            this.chrAliasTable.set(chr, alias)  // alias may be undefined => no alias exists. Setting prevents repeated attempts
         }
+        return refId
+    }
+
+
+    async readAlignments(chr, bpStart, bpEnd) {
 
         const header = await this.getHeader()
-        const queryChr = header.chrAliasTable.hasOwnProperty(chr) ? header.chrAliasTable[chr] : chr
-        const chrIdx = header.chrToIndex[queryChr]
+
+        const chrIdx = await this.#getRefId(chr)
+
         const alignmentContainer = new AlignmentContainer(chr, bpStart, bpEnd, this.config)
 
         if (chrIdx === undefined) {

test/testCRAM.js

@@ -0,0 +1,81 @@
+import "./utils/mockObjects.js"
+import BamReader from "../js/bam/bamReader.js"
+import {assert} from 'chai'
+import BamReaderNonIndexed from "../js/bam/bamReaderNonIndexed.js"
+import {createGenome} from "./utils/MockGenome.js"
+
+
+const genome = createGenome()
+
+suite("testBAM", function () {
+
+    test("BAM alignments - CSI index", async function () {
+
+        const start = 155140000
+        const end = 155160000
+
+        const bamReader = new BamReader({
+                type: 'bam',
+                url: 'test/data/bam/na12889.cram',
+                indexURL: 'test/data/bam/na12889.cram.crai'
+            },
+            genome)
+
+
+        alignmentContainer = await bamReader.readAlignments("1", start, end)
+        validate(assert, alignmentContainer)
+
+    })
+
+
+    function validate(assert, alignmentContainer) {
+        assert.ok(alignmentContainer)
+
+        // 2 alignments, 1 paired and 1 single
+        assert.equal(alignmentContainer.alignments.length, 2)
+
+        const firstAlignment = alignmentContainer.alignments[0].firstAlignment
+
+        assert.equal(firstAlignment.seq, 'TTCATCTAAAAATCACATTGCAAATTATTCAATATATTTGGGCCTCCATCTCGTTTACATCAATATGTGTTTGTTGAAGTATCTGCCCTGCAATGTCCATA')
+
+        assert.deepEqual(firstAlignment.qual, [34, 9, 12, 10, 24, 17, 10, 5, 19, 7, 28, 17, 23, 29, 10,
+            26, 10, 8, 14, 7, 15, 17, 32, 33, 31, 23, 34, 16, 33, 28, 34, 27, 10, 29, 10, 17, 11, 26,
+            8, 27, 4, 4, 35, 32, 12, 32, 40, 39, 38, 41, 40, 36, 3, 34, 17, 30, 37, 10, 29, 36, 41,
+            35, 24, 34, 11, 19, 11, 16, 24, 16, 26, 10, 11, 19, 13, 18, 11, 28, 30, 37, 30, 38, 43,
+            43, 40, 43, 43, 41, 32, 34, 39, 41, 31, 37, 36, 36, 36, 33, 37, 34, 30])
+
+        assert.equal(firstAlignment.start, 155148856)
+        assert.equal(firstAlignment.scStart, 155148856 - 20)
+        assert.equal(firstAlignment.lengthOnRef, 81)
+        assert.equal(firstAlignment.scLengthOnRef, 101)
+        assert.equal(firstAlignment.pairOrientation, 'F2R1')
+        assert.equal(firstAlignment.fragmentLength, 307)
+        assert.equal(firstAlignment.mq, 29)
+
+        const blocks = firstAlignment.blocks
+        assert.equal(blocks.length, 4)
+        const expectedLength = [20, 46, 8, 24]
+        const expectedOffset = [0, 20, 66, 77]
+        const expectedTypes = ['S', 'M', 'M', 'M']
+        for (let i = 0; i < 4; i++) {
+            const b = blocks[i]
+            assert.equal(b.len, expectedLength[i])
+            assert.equal(b.type, expectedTypes[i])
+            assert.equal(b.seqOffset, expectedOffset[i])
+        }
+
+        const insertions = firstAlignment.insertions
+        assert.equal(insertions.length, 1)
+        assert.equal(insertions[0].len, 3)
+        assert.equal(insertions[0].type, 'I')
+
+        const tags = firstAlignment.tags()
+        assert.equal(tags["BQ"], "@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@TPEO@@KPXPZJKS@@@@@@@@@@@@@@@@@@@@@@@@@@@")
+        assert.equal(tags["AM"], 29)
+        assert.equal(tags["MQ"], 29)
+        assert.equal(tags["AM"], 29)
+        assert.equal(tags["XT"], "M")
+    }
+
+})
+

test/utils/JBrowseFileHandler.js

@@ -0,0 +1,29 @@
+import fs from 'fs';
+
+export default class LocalFile {
+    // eslint-disable-next-line @typescript-eslint/no-unused-vars
+    constructor(source, opts = {}) {
+        this.filename = source;
+    }
+    getFd() {
+        if (!this.fd) {
+            this.fd = fs.openSync(this.filename, 'r');
+        }
+        return this.fd;
+    }
+    async read(buffer, offset = 0, length, position = 0) {
+        const fetchLength = Math.min(buffer.length - offset, length);
+        const ret = await fs.readSync(await this.getFd(), buffer, offset, fetchLength, position);
+        return { bytesRead: ret, buffer };
+    }
+    async readFile(options) {
+        return fs.readFileSync(this.filename, options);
+    }
+    // todo memoize
+    async stat() {
+        return fs.statSync(this.filename);
+    }
+    async close() {
+        return fs.closeSync(this.filename);
+    }
+}