Bug fix -- chromosome names from CRAM files were unset.

Add a unit test for CRAM files

js/cram/cramReader.js

@@ -85,7 +85,7 @@ class CramReader {
             this.header = {
                 indexToChr: indexToChr,
                 chrToIndex: chrToIndex,
-                chrNames: new Set(Object.keys(chrToIndex)),
+                chrNames: Object.keys(chrToIndex),
                 readGroups: readGroups
 
             }

js/vendor/updating_cram-bundle.md

@@ -0,0 +1,34 @@
+To update the cram-js bundle
+
+(1)  clone the GMode cram-js repository:  https://github.com/GMOD/cram-js
+
+(2)  build dist bundle
+
+```bash
+yarn install
+npm run build
+```
+
+(3) copy `<cram-js repo>/dist/cram-bundle.js`  to `<igv.js-repo>/js/vendor/cram-bundle.js`
+
+Edit `cram-bundle.js` as follows. (The gmod distribution bundle sets a windows global, and does not provide an ES6
+export.  The modification below will convert the bundle to an ES6 module, required by igv.js)
+
+(4) Add an export default statment to the beginning of the file
+
+```js
+ export default (() => {
+    var e = {368....
+```
+
+(5) replace ```window.gmodCram=n``` at the end of the file with ```return n```
+
+```js
+var n = r(5590);
+return n
+})
+();
+```
+
+
+

test/testCram.js

@@ -0,0 +1,94 @@
+import "./utils/mockObjects.js"
+import {assert} from 'chai'
+import Genome from "../js/genome/genome.js"
+import CramReader from "../js/cram/cramReader.js"
+import LocalFile from "./utils/JBrowseFileHandler.js"
+
+// Hack neccessary for unit testing cram bundle
+Buffer.isBuffer = function isBuffer (b) {
+    return ArrayBuffer.isView(b)
+}
+
+// Need an actual genome object for this test, not a mock object
+const genome = await Genome.createGenome({
+    id: "hg19",
+    "fastaURL": "https://igv-genepattern-org.s3.amazonaws.com/genomes/seq/hg19/hg19.fasta",
+    "indexURL": "https://igv-genepattern-org.s3.amazonaws.com/genomes/seq/hg19/hg19.fasta.fai",
+
+})
+
+suite("testCRAM", function () {
+
+    this.timeout(20000)
+
+    test("CRAM", async function () {
+
+        const start = 155140000
+        const end = 155160000
+
+        const cramReader = new CramReader({
+                type: 'cram',
+                url: 'test/data/cram/na12889.cram',
+                indexURL: 'test/data/cram/na12889.cram.crai'
+            },
+            genome)
+
+        const alignmentContainer = await cramReader.readAlignments("chr1", start, end)
+        validate(assert, alignmentContainer)
+
+    })
+
+
+    function validate(assert, alignmentContainer) {
+        assert.ok(alignmentContainer)
+
+        // 2 alignments, 1 paired and 1 single
+        assert.equal(alignmentContainer.alignments.length, 2)
+
+        const firstAlignment = alignmentContainer.alignments[0].firstAlignment
+
+        assert.equal()
+
+        assert.equal(firstAlignment.seq, 'TTCATCTAAAAATCACATTGCAAATTATTCAATATATTTGGGCCTCCATCTCGTTTACATCAATATGTGTTTGTTGAAGTATCTGCCCTGCAATGTCCATA')
+
+        assert.deepEqual(firstAlignment.qual, [34, 9, 12, 10, 24, 17, 10, 5, 19, 7, 28, 17, 23, 29, 10,
+            26, 10, 8, 14, 7, 15, 17, 32, 33, 31, 23, 34, 16, 33, 28, 34, 27, 10, 29, 10, 17, 11, 26,
+            8, 27, 4, 4, 35, 32, 12, 32, 40, 39, 38, 41, 40, 36, 3, 34, 17, 30, 37, 10, 29, 36, 41,
+            35, 24, 34, 11, 19, 11, 16, 24, 16, 26, 10, 11, 19, 13, 18, 11, 28, 30, 37, 30, 38, 43,
+            43, 40, 43, 43, 41, 32, 34, 39, 41, 31, 37, 36, 36, 36, 33, 37, 34, 30])
+
+        assert.equal(firstAlignment.start, 155148856)
+        assert.equal(firstAlignment.scStart, 155148856 - 20)
+        assert.equal(firstAlignment.lengthOnRef, 81)
+        assert.equal(firstAlignment.scLengthOnRef, 101)
+        assert.equal(firstAlignment.pairOrientation, 'F2R1')
+        assert.equal(firstAlignment.fragmentLength, 307)
+        assert.equal(firstAlignment.mq, 29)
+
+        const blocks = firstAlignment.blocks
+        assert.equal(blocks.length, 4)
+        const expectedLength = [20, 46, 8, 24]
+        const expectedOffset = [0, 20, 66, 77]
+        const expectedTypes = ['S', 'M', 'M', 'M']
+        for (let i = 0; i < 4; i++) {
+            const b = blocks[i]
+            assert.equal(b.len, expectedLength[i])
+            assert.equal(b.type, expectedTypes[i])
+            assert.equal(b.seqOffset, expectedOffset[i])
+        }
+
+        const insertions = firstAlignment.insertions
+        assert.equal(insertions.length, 1)
+        assert.equal(insertions[0].len, 3)
+        assert.equal(insertions[0].type, 'I')
+
+        const tags = firstAlignment.tags()
+        assert.equal(tags["BQ"], "@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@TPEO@@KPXPZJKS@@@@@@@@@@@@@@@@@@@@@@@@@@@")
+        assert.equal(tags["AM"], 29)
+        assert.equal(tags["MQ"], 29)
+        assert.equal(tags["AM"], 29)
+        assert.equal(tags["XT"], "M")
+    }
+
+})
+