Skip to content

Fully Automated and Standardized (FAST) iCLIP analysis pipeline.

License

Notifications You must be signed in to change notification settings

jinxu937/FAST-iCLIP

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

FAST-iCLIP

Fully Automated and Standardized iCLIP (FAST-iCLIP) is a fully automated tool to process iCLIP data. Please cite the following paper:

Flynn RA, Martin L, Spitale RC, Do BT, Sagan SM, Zarnegar B, Qu K, Khavari PA, Quake SR, Sarnow P, Chang HY (2014). Dissecting non-coding and pathogen RNA-protein interactomes. RNA 21:1, 1-9. doi:10.1261/rna.047803.114

This package contains two main sets of tools: an executable called fasticlip to run iCLIP on human and mouse data, and several iPython notebooks to process iCLIP data from viral genomes.

The following README will focus mainly on fasticlip. The pdf in the repository contains further instructions for using the iPython notebooks.

Table of Contents

Usage

fasticlip [-h] -i INPUT [INPUT ...] [--trimmed] [--hg19 | --mm9] -s STAR_INDEX -n NAME -o OUTPUT [-f N] [-a ADAPTER] [-tr REPEAT_THRESHOLD_RULE] [-tn NONREPEAT_THRESHOLD_RULE] [-sr STAR_RATIO] [-bm BOWTIE_MAPQ] [-q Q] [-p P] [-l L] [--verbose]

Example: fasticlip -i rawdata/example_MMhur_R1.fastq rawdata/example_MMhur_R2.fastq --mm9 -s /seq/STAR/indexes/mm9 -n MMhur -o results

Required arguments

flag description
-h, --help show this help message and exit
-i INPUT(s) At least one input FASTQ (or fastq.gz) files; separated by spaces
--hg19 required if your CLIP is from human
--mm9 required if your CLIP is from mouse
-s STAR_INDEX Path to STAR index for your organism
-n NAME Name of output directory
-o OUTPUT Name of directory where output directory will be made

Optional arguments

flag description
--trimmed flag if files are already trimmed
-f N Number of bases to trim from 5' end of each read. Default is 14.
-a ADAPTER 3' adapter to trim from the end of each read. Default is A GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG.
-tr REPEAT_THRESHOLD_RULE m,n: at least m samples must each have at least n RT stops mapped to repeat RNAs. Default is 1,4 (1 sample); 2,3 (2 samples); x,2 (x>2 samples)
-tn NONREPEAT_THRESHOLD_RULE m,n: at least m samples must each have at least n RT stops mapped to nonrepeat RNAs. Default is 1,4 (1 sample); 2,3 (2 samples); x,2 (x>2 samples)
-sr STAR_RATIO Maximum mismatches per base allowed for STAR genome mapping (corresponds to outFilterMismatchNoverLmax). Default is 0.08 (2 mismatches per 25 mapped bases).
-bm BOWTIE_MAPQ Minimum MAPQ (Bowtie alignment to repeat/tRNA/retroviral indexes) score allowed. Default is 42.
-q Q Minimum average quality score allowed during read filtering. Default is 25.
-p P Percentage of bases that must have quality > q during filtering. Default is 80.
-l L Minimum length of read. Default is 15.
--clipper run CLIPper on data. Not recommended as we find that this removes a lot of true CLIP reads
--verbose Prints out lots of things :)

Installation instructions

  1. Clone this repository by running one of the following:
    • git clone [email protected]:ChangLab/FAST-iCLIP.git if you use ssh authentication
    • git clone https://github.com/ChangLab/FAST-iCLIP.git otherwise
  2. Type cd FAST-iCLIP to enter the folder.
  3. Run ./configure. This will check for dependencies (below) and download necessary files (bowtie indices, gene lists and genomes, and example iCLIP data).
  4. Run sudo python setup.py install. If you do not have sudo privileges, run python setup.py install --user or python setup.py install --prefix=<desired directory>.
  5. You should see three new folders inside FAST-iCLIP: docs, rawdata, and results.
  6. Make your genome index for STAR. Once STAR is installed, run the following: STAR --runMode genomeGenerate --runThreadN 8 --genomeDir <your desired folder> --genomeFastaFiles <genome FASTA file>. You can download FASTA files from http://hgdownload.cse.ucsc.edu/downloads.html.
  7. Try running the following command: fasticlip -i rawdata/example_MMhur_R1.fastq rawdata/example_MMhur_R2.fastq --mm9 -s <location of your STAR index> -n MMhur -o results. It should run in ~1 hour. Look inside results/MMhur for output files.

You can fasticlip from outside its installation directory. To do this, add the following lines to the end of your .bash_profile script:

export FASTICLIP_PATH=<your absolute FAST-iCLIP installation path>
export PATH=$FASTICLIP_PATH:$PATH

Save the file, then run source ~/.bash_profile.

Dependencies

  1. Python 2.7: https://www.python.org/download/releases/2.7/
  2. iPython: http://ipython.org/install.html (optional)
  3. iPython notebook: http://ipython.org/notebook (optional)
  4. Matplotlib for Python (plotting): http://matplotlib.org/
  5. Pandas for Python (data): http://pandas.pydata.org/
  6. Bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
  7. STAR: https://github.com/alexdobin/STAR
  8. bedtools: http://bedtools.readthedocs.org/en/latest/
  9. CLIPper: https://github.com/YeoLab/clipper/wiki/CLIPper-Home (now optional)
  10. FASTX-Tookit: http://hannonlab.cshl.edu/fastx_toolkit/
  11. Matplotlib-venn for Python: https://pypi.python.org/pypi/matplotlib-venn
  12. iCLIPro: http://www.biolab.si/iCLIPro/doc/

Input

At least one FASTQ or compressed FASTQ (fastq.gz). Use the --trimmed flag if trimming has already been done.

Output

Three subdirectories inside the named directory within results.

  • figures has 6 figures in pdf and png format.

    • Figure 1 visualizes the some of the relevant summary data.

      • It includes a read count summary per pipeline step. The source data is: PlotData_ReadsPerPipeFile
      • It includes a pie chart of UTR binding.
      • This uses reads obtrained from intersection with ENSEMBL-derived UTR coordinates.
      • The source data is: PlotData_ReadsPerGene_*UTR or CDS
      • It also includes a bar graph of gene count per RNA type.
      • The source data is: PlotData_ReadAndGeneCountsPerGenetype
    • Figure 2 provides a richer summary of the UTR data.

      • The upper panel is an aggregate trace of binding derived from a custom perl script.
      • The lower panels provide a heatmap of binding intensity for gene exclusivly bound in each UTR or CDS.
      • This allows us to isolate genes with exclusive UTR,CDS,or intronic binding.
      • The source data is: PlotData_ExclusiveBound_*
    • Figures 3 and 4 provide coverage histograms of binding across each repeat RNA and rRNA, respectivly.

      • Source data: PlotData_RepeatRNAHist_*
    • Figure 5 provides a summary of snoRNA binding data.

      • The pie chart provides a summary of reads per snoRNA type.
      • These are complimented by histograms of RT stop position within the snoRNA gene body.
    • Figure 6 provides histograms of RT stop position within gene body for all remaining ncRNA types.

  • rawdata has all the PlotData files used to make the figures, as well as intermediate files that can be useful in generating other plots.

  • todelete has files that are unnecessary to keep.

How the pipeline works

  1. Prepare 2 FASTQ or FASTQ.gz files corresponding to the two replicates for the iCLIP experiment.

  2. Duplicate removal, quality filter, and trim adapter from the 3' end from the reads

  • Duplicate removal:
    • This step takes advantage of the fact that 5' end of each read has a random barcode.
    • Each initial starting molecule that was RT'd will have a unique barcode.
    • Therefore, PCR duplicates are removed by collapsing molecules with identical 5' barcode sequences.
  • RT primer is cleaved, leaving adapters.
  • Remove adapter region from the 3' end of the read.
  • The adapter is an optional input parameter.
  • Default is to remove sequences less than N=33 nucleotides.
  • Q33 specifies the quality score encoding format.
  1. After duplicate removal, remove the 5' barcode sequence. Default is 13 nt removed.

  2. We then map to a repeat index, then to a tRNA index, then to a genome index.

  • We only keep reads that are unique and perfectly aligned.
  • We then remove reads that map to blacklist or repeat regions.
  1. After mapping, we isolate the 5' position (RT) stop for both positive and negative strand reads.
  • This represents the cross-link site in the initial experiment.
  1. For each strand, we merge RT stops between replicates.
  • This means that at RT stop position must be conserved between replicates.
  • If conserved, we count the total number of instances of the RT position for both replicates.
  • If the total counts exceed a specified threshold, then we record these RT stops.
  • Finally, we re-generate a "read" around the RT stop using the passed parameter "expand,"
  • A "read" around the RT stop is required for downstream processing.
  1. Expanded reads from RT stop merging are passed to CLIPper, a peak calling algorithm.
  • CLIPper returns a bed-like file format with window coordinates, reads counted per window, etc.
  • We use these windows to extract "low FDR" reads from the total set of reads passed to CLIPper.
  • We then make bedGraph and BigWig files from this complete pool of "low FDR" reads, allowing easy visualization.
  1. Partition "low FDR" reads by gene type.
  • We partition the gene names recoved from CLIPper using ENSEMBL annotation of gene name by RNA type.
  • Once this is done, we also split the "low FDR" reads recovered from CLIPper by type using the gene name.
  • Protein coding and lincRNA genes can be embedded snoRNAs or miRNAs that make this more challenging.
  • In turn, we re-generate the initial RT stop and intersect this with two different filters.
  • One filter is a snoRNA mask and the other filter is a miR mask.
  • Both are derived from Ensembl annotations.
  • These masks allow us to remove all "protein coding" RT stops that fall within annotated sno/mi-RNA regions.
  1. Quantification of reads per gene.
  • For each gene type, we quantify the number of reads per gene.
  • For all but snoRNAs, this is computed using the bed files obtained above.
  • For snoRNAs, we intersect the initial pool of "low FDR" reads with custom annotation file.
  • The custom annotation file is a summation of UCSC, Rfam, and ENSEMBL loci annotated as snoRNAs as no individual annotation entirely captured all known loci.
  • Collectively, this gives us reads per gene for each gene type.
  • All are based upon ENSEMBL annotation except for the snoRNAs.
  1. Summary of RT stop intensity around CLIPper cluster centers.
  • We generate a bed file of cluster center positions using the CLIPper cluster file output.
  • We use a custom perl script that generates a heatmap of RT stop intensty per cluster.
  • This allows us to later visualize the distribution of RT stops per cluster.
  1. Partition protein coding reads by UTR.
  • We intersect sno/mi-RNA filtered reads with ENSEMBL-derived UTR coordinates.
  • We perform this such that each read assignment is mutually exclusive.
  • This only isolates reads that fall within each UTR type.
  • Similarly, we use a custom perl script to generate a matrix of read intensity per gene.
  • This provides a complete binding profile per gene.
  1. Partition reads by ncRNA binding region.
  • For non-coding RNAs, we simply annotate reads with the start and stop position for each ncRNA.
  • This allows us to determine the position of each RT stop with respect to the full length of the gene.
  1. Partition repeat-mapped RT stops by region.
  • The repeat RNA mapped RT stops are paritioned using the repeat custom index annotation.
  • As with the ncRNAs, this is later used for visualization.

About

Fully Automated and Standardized (FAST) iCLIP analysis pipeline.

Resources

License

Stars

Watchers

Forks

Packages

No packages published

Languages

  • Jupyter Notebook 68.5%
  • Python 30.2%
  • Perl 1.3%