rna_pdb_tools.py --get-ss causes NameError. fix #146

rna_tools/output/secondary_structures.txt

@@ -0,0 +1,126 @@
+input/1xjr.pdb
+>1xjr nts=47 [whole]
+gGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+..(((((((...((((.((((.....))..))..))).).)))))))
+>1xjr-A #1 nts=47 0.27(3.09) [chain] RNA
+gGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+..(((((((...((((.((((.....))..))..))).).)))))))
+
+input/1xjr_A1-4.pdb
+>1xjr_A1-4 nts=4 [whole]
+GGAG
+....
+>1xjr_A1-4-A #1 nts=4 2.61(0.09) [chain] RNA
+GGAG
+....
+
+input/1xjr_A3-4.pdb
+>1xjr_A3-4 nts=2 [whole]
+AG
+..
+>1xjr_A3-4-A #1 nts=2 [chain] RNA
+AG
+..
+
+input/1xjr_A5-10.pdb
+>1xjr_A5-10 nts=6 [whole]
+UUCACC
+......
+>1xjr_A5-10-A #1 nts=6 2.73(0.10) [chain] RNA
+UUCACC
+......
+
+input/1xjr_C10-11.pdb
+>1xjr_C10-11 nts=2 [whole]
+AG
+..
+>1xjr_C10-11-C #1 nts=2 [chain] RNA
+AG
+..
+
+input/1xjr_GTP.pdb
+>1xjr_GTP nts=1 [whole]
+g
+.
+>1xjr_GTP-A #1 nts=1 [chain] RNA
+g
+.
+
+input/1xjr_ba.pdb
+>1xjr_ba nts=47 [whole]
+gGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+..(((((((...((((.((((.....))..))..))).).)))))))
+>1xjr_ba-1-A #1 nts=47 0.27(3.09) [chain] RNA
+gGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+..(((((((...((((.((((.....))..))..))).).)))))))
+
+input/1xjr_clx_charmm.pdb
+>1xjr_clx_charmm nts=46 [whole]
+GAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+.(((((((...((((.((((.....))..))..))).).)))))))
+>1xjr_clx_charmm-A #1 nts=46 0.27(3.12) [chain] RNA
+GAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+.(((((((...((((.((((.....))..))..))).).)))))))
+
+input/1xjr_missing_atom.pdb
+>1xjr_missing_atom nts=3 [whole]
+gGA
+...
+>1xjr_missing_atom-A #1 nts=3 2.98(0.03) [chain] RNA
+gGA
+...
+
+input/1xjr_no_op3.pdb
+>1xjr_no_op3 nts=2 [whole]
+g&A
+.&.
+>1xjr_no_op3-A #1 nts=1 [chain] RNA
+g
+.
+>1xjr_no_op3-B #2 nts=1 [chain] RNA
+A
+.
+
+input/1xjr_no_op3_simrna_ready.pdb
+>1xjr_no_op3_simrna_ready nts=2 [whole]
+G&A
+.&.
+>1xjr_no_op3_simrna_ready-A #1 nts=1 [chain] RNA
+G
+.
+>1xjr_no_op3_simrna_ready-B #2 nts=1 [chain] RNA
+A
+.
+
+input/1xjr_onlyGTP.pdb
+>1xjr_onlyGTP nts=1 [whole]
+g
+.
+>1xjr_onlyGTP-A #1 nts=1 [chain] RNA
+g
+.
+
+input/1xjr_onlyGTP_X.pdb
+>1xjr_onlyGTP_X nts=1 [whole]
+G
+.
+>1xjr_onlyGTP_X-A #1 nts=1 [chain] RNA
+G
+.
+
+input/1xjr_rpr.pdb
+>1xjr_rpr nts=47 [whole]
+GGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+..(((((((...((((.((((.....))..))..))).).)))))))
+>1xjr_rpr-A #1 nts=47 0.27(3.09) [chain] RNA
+GGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+..(((((((...((((.((((.....))..))..))).).)))))))
+
+input/1xjr_std.pdb
+>1xjr_std nts=47 [whole]
+GGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+..(((((((...((((.((((.....))..))..))).).)))))))
+>1xjr_std-A #1 nts=47 0.27(3.09) [chain] RNA
+GGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
+..(((((((...((((.((((.....))..))..))).).)))))))
+

rna_tools/tools/rna_x3dna/rna_x3dna.py

@@ -55,7 +55,8 @@ def get_parser():
     parser = argparse.ArgumentParser(
         description=__doc__, formatter_class=argparse.RawDescriptionHelpFormatter)
     parser.add_argument('-c', '--compact',  action='store_true')
-    parser.add_argument('--rerun',  action='store_true')
+    parser.add_argument('-x', '--rerun',  action='store_true')
+    parser.add_argument('-s', '--show',  action='store_true', help="show results")
     parser.add_argument('--pymol',  action='store_true', help='get resi to color code puckers in PyMOL')
     parser.add_argument('-l', '--show-log',  action='store_true', help="show full log")
     parser.add_argument('-v', '--verbose',  action='store_true', help="show full log")
@@ -112,7 +113,7 @@ def get_modifications(self):
                 text += l.replace('uncommon residue ', '') + '\n'
         return text.strip()
 
-    def run_x3dna(self, show_log=False):
+    def run_x3dna(self, show_log=False, verbose=False):
         """
         """
         cmd = X3DNA + ' -i=' + self.curr_fn
@@ -122,7 +123,7 @@ def run_x3dna(self, show_log=False):
         outerr = str(out.stderr.read().decode())
 
         f = open('py3dna.log', 'w')
-        if args.verbose: print(f'cmd: {cmd}')
+        if verbose: print(f'cmd: {cmd}')
         f.write(cmd + '\n' + stdout)
 
         if show_log:
@@ -182,13 +183,18 @@ def get_seq(self):
 
         Somehow 1bzt_1 x3dna	UCAGACUUUUAAPCUGA, what is P?
         P -> u
+        
         """
         return self.report.split('\n')[-2].replace('P', 'u').replace('I', 'a')
 
     def get_secstruc(self):
         """Get secondary structure.
         """
-        return self.report.split('\n')[-1]
+        hits = re.search("as a whole and per chain.*?\n(?P<ss>.+?)\n\*", self.report, re.DOTALL|re.MULTILINE)
+        if hits:
+             return hits.group('ss')
+        else:
+            self.report.split('\n')[-1] # tofix
 
     def get_torsions(self, outfn) -> str:
         """Get torsion angles into 'torsion.csv' file::
@@ -246,6 +252,11 @@ def get_torsions(self, outfn) -> str:
         nangles = re.sub(r'---', 'nan', nangles, 0, re.MULTILINE)
         with open(outfn, 'w') as f:
             f.write(nangles.strip())
+
+        if args.show:
+            import pandas as pd
+            df = pd.read_csv(outfn)
+            print(df)
         return nangles.strip()
 
 # name
@@ -275,12 +286,13 @@ def get_torsions(self, outfn) -> str:
             outfn = os.path.basename(f.replace('.pdb', '')) + '-torsion-paired.csv'
             if not args.rerun:
                 if os.path.isfile(outfn):
+                    print(f'skip: {f}, use --rerun to run analysis again')
                     continue
-            p = x3DNA(f, args.show_log)
-            #s = p.get_seq()
-            #print(s)
-            #s = p.get_secstruc()
-            #print(s)
+            p = x3DNA(f, args.show_log, args.verbose)
+            s = p.get_seq()
+            print(s)
+            s = p.get_secstruc()
+            print(s)
             s = p.get_torsions(outfn)
             if args.verbose: print(s)
             p.clean_up(args.verbose)