formatting #9
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
--- | |
name: Docker Image | |
on: [push] | |
jobs: | |
test: | |
name: Docker Image | |
runs-on: ubuntu-20.04 | |
steps: | |
- name: Checkout | |
uses: actions/checkout@v2 | |
- name: Build Docker Image | |
run: | | |
docker build -t knotify:dev . | |
- name: Test Docker Image | |
run: | | |
docker run knotify:dev /knotify/bin/rna_analysis --sequence AAAAAACUAAUAGAGGGGGGACUUAGCGCCCCCCAAACCGUAACCCC |