Update README.md

whitead · Jul 3, 2022 · 7e5386f · 7e5386f
1 parent f5aacc1
commit 7e5386f
Showing 1 changed file with 7 additions and 2 deletions.
diff --git a/README.md b/README.md
@@ -1,5 +1,7 @@
 # molcloud [![build](https://github.com/whitead/molcloud/actions/workflows/tests.yml/badge.svg)](https://whitead.github.io/molcloud/)[![PyPI version](https://badge.fury.io/py/molcloud.svg)](https://badge.fury.io/py/molcloud)
 
+This package draws molecules (or RNA, thanks to [@Shunsuke-1994](https://github.com/Shunsuke-1994)) in a big canvas packed together. See examples below. 
+
 ## Install
 
 Make sure you have [pygraphviz installed](https://pygraphviz.github.io/documentation/stable/install.html)
@@ -32,7 +34,7 @@ Adjust width as you add more molecules. The drawing is always square (sorry).
 
 ## RNA Install
 
-To install layout RNA, install the extra packages:
+Thanks to [@Shunsuke-1994](https://github.com/Shunsuke-1994)! To install layout RNA, install the extra packages:
 
 ```sh
 pip install molcloud[rna]
@@ -55,4 +57,7 @@ UUCCAGCACCUGAUGUUCGAAUUUAAAUCGGCUCAACGAG
 
 ![test](https://user-images.githubusercontent.com/908389/176980703-bc814295-ee37-4c41-a31b-6b75bb420659.png)
 
-## RNA Example
+## RNA Example
+
+![rna](https://user-images.githubusercontent.com/908389/177061306-8caea628-12a4-4ccd-ae7d-ae240ba3adb1.png)
+