dev -> staging

pipeline_versions.txt

@@ -27,14 +27,14 @@ ExternalExomeReprocessing	 3.3.3	2024-11-04
 CramToUnmappedBams	 1.1.3	2024-08-02 
 WholeGenomeReprocessing	 3.3.3	2024-11-04 
 ExomeReprocessing	 3.3.3	2024-11-04 
-BuildIndices	 3.0.0	2023-12-06 
+BuildIndices	 3.1.0	2024-11-26 
 scATAC	 1.3.2	2023-08-03 
 snm3C	 4.0.4	2024-08-06 
-Multiome	 5.9.1	2024-11-12 
-PairedTag	 1.8.2	2024-11-12 
+Multiome	 5.9.3	2024-12-3 
+PairedTag	 1.8.4	2024-12-3 
 MultiSampleSmartSeq2	 2.2.22	2024-09-11 
-MultiSampleSmartSeq2SingleNucleus	 2.0.4	2024-11-12 
-Optimus	 7.8.2	2024-11-12 
-atac	 2.5.2	2024-11-12 
+MultiSampleSmartSeq2SingleNucleus	 2.0.6	2024-11-15 
+Optimus	 7.8.4	2024-12-3 
+atac	 2.5.3	2024-11-22 
 SmartSeq2SingleSample	 5.1.21	2024-09-11 
-SlideSeq	 3.4.5	2024-11-12 
+SlideSeq	 3.4.7	2024-12-3 

pipelines/skylab/atac/atac.changelog.md

@@ -1,3 +1,8 @@
+# 2.5.3
+2024-11-22 (Date of Last Commit)
+
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files; does not impact ATAC workflow
+
 # 2.5.2
 2024-11-12 (Date of Last Commit)
 

pipelines/skylab/atac/atac.wdl

@@ -49,15 +49,15 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "2.5.2"
+  String pipeline_version = "2.5.3"
 
   # Determine docker prefix based on cloud provider
   String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"
   String acr_docker_prefix = "dsppipelinedev.azurecr.io/"
   String docker_prefix = if cloud_provider == "gcp" then gcr_docker_prefix else acr_docker_prefix
 
   # Docker image names
-  String warp_tools_2_2_0 = "warp-tools:2.2.0"
+  String warp_tools_2_2_0 = "warp-tools:2.5.0"
   String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919"
   String samtools_docker = "samtools-dist-bwa:3.0.0"
   String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311"

pipelines/skylab/build_indices/BuildIndices.changelog.md

@@ -1,3 +1,8 @@
+# 3.1.0
+2024-11-26 (Date of Last Commit)
+
+* Added metadata.txt file as an output to the pipeline
+
 # 3.0.0
 2023-12-06 (Date of Last Commit)
 

pipelines/skylab/build_indices/BuildIndices.wdl

@@ -16,7 +16,7 @@ workflow BuildIndices {
   }
 
   # version of this pipeline
-  String pipeline_version = "3.0.0"
+  String pipeline_version = "3.1.0"
 
 
   parameter_meta {
@@ -49,12 +49,25 @@ workflow BuildIndices {
         organism = organism
     }
 
+    call RecordMetadata {
+      input:
+      pipeline_version = pipeline_version,
+      input_files = [annotations_gtf, genome_fa, biotypes],
+      output_files = [
+      BuildStarSingleNucleus.star_index,
+      BuildStarSingleNucleus.modified_annotation_gtf,
+      CalculateChromosomeSizes.chrom_sizes,
+      BuildBWAreference.reference_bundle
+      ]
+    }
+
   output {
     File snSS2_star_index = BuildStarSingleNucleus.star_index
     String pipeline_version_out = "BuildIndices_v~{pipeline_version}"
     File snSS2_annotation_gtf_modified = BuildStarSingleNucleus.modified_annotation_gtf
     File reference_bundle = BuildBWAreference.reference_bundle
     File chromosome_sizes = CalculateChromosomeSizes.chrom_sizes
+    File metadata = RecordMetadata.metadata_file
   }
 }
 
@@ -195,3 +208,61 @@ String reference_name = "bwa-mem2-2.2.1-~{organism}-~{genome_source}-build-~{gen
   }
 }
 
+
+task RecordMetadata {
+  input {
+    String pipeline_version
+    Array[File] input_files
+    Array[File] output_files
+  }
+
+  command <<<
+    set -euo pipefail
+
+    # create metadata file
+    echo "Pipeline Version: ~{pipeline_version}" > metadata.txt
+    echo "Date of Workflow Run: $(date -u +%Y-%m-%dT%H:%M:%SZ)" >> metadata.txt
+    echo "" >> metadata.txt
+
+    # echo paths and md5sums for input files
+    echo "Input Files and their md5sums:" >> metadata.txt
+    for file in ~{sep=" " input_files}; do
+      echo "$file : $(md5sum $file | awk '{print $1}')" >> metadata.txt
+    done
+    echo "" >> metadata.txt
+
+    # echo paths and md5sums for input files
+    echo "Output Files and their md5sums:" >> metadata.txt
+    for file in ~{sep=" " output_files}; do
+      echo "$file : $(md5sum $file | awk '{print $1}')" >> metadata.txt
+    done
+    echo "" >> metadata.txt
+
+    # grab workspace bucket
+    file="~{output_files[0]}"
+    workspace_bucket=$(echo $file | awk -F'/' '{print $3}')
+    echo "Workspace Bucket: $workspace_bucket" >> metadata.txt
+
+    # grab submission ID
+    submission_id=$(echo $file | awk -F'/' '{print $5}')
+    echo "Submission ID: $submission_id" >> metadata.txt
+
+    # grab workflow ID
+    workflow_id=$(echo $file | awk -F'/' '{print $7}')
+    echo "Workflow ID: $workflow_id" >> metadata.txt
+
+    echo "" >> metadata.txt
+  >>>
+
+  output {
+    File metadata_file = "metadata.txt"
+  }
+
+  runtime {
+    docker: "ubuntu:20.04"
+    memory: "5 GiB"
+    disks: "local-disk 100 HDD"
+    cpu: "1"
+  }
+}
+

pipelines/skylab/multiome/Multiome.changelog.md

@@ -1,3 +1,14 @@
+# 5.9.3
+2024-12-3 (Date of Last Commit)
+
+* Fixed a bug in the StarSoloFastq task that caused the pipeline to not output a UniqueAndMult-Uniform.mtx when --soloMultiMappers Uniform was passed to STAR
+
+# 5.9.2
+2024-11-22 (Date of Last Commit)
+
+* Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files
+
 # 5.9.1
 2024-11-12 (Date of Last Commit)
 

pipelines/skylab/multiome/Multiome.wdl

@@ -9,7 +9,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow Multiome {
 
-    String pipeline_version = "5.9.1"
+    String pipeline_version = "5.9.3"
 
     input {
         String cloud_provider

pipelines/skylab/optimus/Optimus.changelog.md

@@ -1,3 +1,14 @@
+# 7.8.4
+2024-12-3 (Date of Last Commit)
+
+* Fixed a bug in the StarSoloFastq task that caused the pipeline to not output a UniqueAndMult-Uniform.mtx when --soloMultiMappers Uniform was passed to STAR
+
+# 7.8.3
+2024-11-22 (Date of Last Commit)
+
+* Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files
+
 # 7.8.2
 2024-11-12 (Date of Last Commit)
 

pipelines/skylab/optimus/Optimus.wdl

@@ -71,7 +71,7 @@ workflow Optimus {
   # version of this pipeline
 
 
-  String pipeline_version = "7.8.2"
+  String pipeline_version = "7.8.4"
 
 
   # this is used to scatter matched [r1_fastq, r2_fastq, i1_fastq] arrays
@@ -91,8 +91,9 @@ workflow Optimus {
   String pytools_docker = "pytools:1.0.0-1661263730"
   String empty_drops_docker = "empty-drops:1.0.1-4.2"
   String star_docker = "star:1.0.1-2.7.11a-1692706072"
-  String warp_tools_docker_2_2_0 = "warp-tools:2.4.0"
+  String warp_tools_docker_2_2_0 = "warp-tools:2.5.0"
   String star_merge_docker = "star-merge-npz:1.3.0"
+  String samtools_star = "samtools-star:1.0.0-1.11-2.7.11a-1731516196"
 
 
   #TODO how do we handle these?
@@ -183,7 +184,7 @@ workflow Optimus {
         count_exons = count_exons,
         output_bam_basename = output_bam_basename + "_" + idx,
         soloMultiMappers = soloMultiMappers,
-        star_docker_path = docker_prefix + star_docker
+        samtools_star_docker_path = docker_prefix + samtools_star
     }
   }
   call Merge.MergeSortBamFiles as MergeBam {

pipelines/skylab/paired_tag/PairedTag.changelog.md

@@ -1,3 +1,14 @@
+# 1.8.4
+2024-12-3 (Date of Last Commit)
+
+* Fixed a bug in the StarSoloFastq task that caused the pipeline to not output a UniqueAndMult-Uniform.mtx when --soloMultiMappers Uniform was passed to STAR
+
+# 1.8.3
+2024-11-22 (Date of Last Commit)
+
+* Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files
+
 # 1.8.2
 2024-11-12 (Date of Last Commit)
 

pipelines/skylab/paired_tag/PairedTag.wdl

@@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow PairedTag {
 
-    String pipeline_version = "1.8.2"
+    String pipeline_version = "1.8.4"
 
 
     input {

pipelines/skylab/slideseq/SlideSeq.changelog.md

@@ -1,3 +1,14 @@
+# 3.4.7
+2024-12-3 (Date of Last Commit)
+
+* Fixed a bug in the StarSoloFastq task that caused the pipeline to not output a UniqueAndMult-Uniform.mtx when --soloMultiMappers Uniform was passed to STAR; this does not affect the outputs of the pipeline
+
+# 3.4.6
+2024-11-15 (Date of Last Commit)
+
+* Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files
+
 # 3.4.5
 2024-11-12 (Date of Last Commit)
 

pipelines/skylab/slideseq/SlideSeq.wdl

@@ -25,7 +25,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow SlideSeq {
 
-    String pipeline_version = "3.4.5"
+    String pipeline_version = "3.4.7"
 
     input {
         Array[File] r1_fastq
@@ -48,7 +48,7 @@ workflow SlideSeq {
     # docker images
     String pytools_docker = "pytools:1.0.0-1661263730"
     String picard_cloud_docker = "picard-cloud:2.26.10"
-    String warp_tools_docker_2_2_0 = "warp-tools:2.4.0"
+    String warp_tools_docker_2_2_0 = "warp-tools:2.5.0"
     String star_merge_docker = "star-merge-npz:1.3.0"
 
     String ubuntu_docker = "ubuntu_16_0_4@sha256:025124e2f1cf4d29149958f17270596bffe13fc6acca6252977c572dd5ba01bf"

pipelines/skylab/smartseq2_single_nucleus_multisample/MultiSampleSmartSeq2SingleNucleus.changelog.md

@@ -1,3 +1,13 @@
+# 2.0.6
+2024-11-15 (Date of Last Commit)
+
+* Fixed a bug in the StarSoloFastq task that caused the pipeline to not output a UniqueAndMult-Uniform.mtx when --soloMultiMappers Uniform was passed to STAR; this does not affect the outputs of the pipeline
+
+# 2.0.5
+2024-11-15 (Date of Last Commit)
+
+* Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline
+
 # 2.0.4
 2024-11-12 (Date of Last Commit)
 

pipelines/skylab/smartseq2_single_nucleus_multisample/MultiSampleSmartSeq2SingleNucleus.wdl

@@ -57,7 +57,7 @@ workflow MultiSampleSmartSeq2SingleNucleus {
   }
 
   # Version of this pipeline
-  String pipeline_version = "2.0.4"
+  String pipeline_version = "2.0.6"
 
   if (false) {
      String? none = "None"

tasks/skylab/FastqProcessing.wdl

@@ -138,7 +138,7 @@ task FastqProcessingSlidSeq {
 
 
     # Runtime attributes
-    String docker =  "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0"
+    String docker =  "us.gcr.io/broad-gotc-prod/warp-tools:2.5.0"
     Int cpu = 16
     Int machine_mb = 40000
     Int disk = ceil(size(r1_fastq, "GiB")*3 + size(r2_fastq, "GiB")*3) + 50