mirdeep2 module

mirdeep2 is a popular miRNA discovery program written in perl. The command line usage is a little complicated so this module allows a configuration file to be used to provide settings. It also analyses the output results of mirdeep and provides summary plots. Requires you install mirdeep2 and add it to your path.

Command line usage

Installing smallrnaseq will add a mirdeep command that can be used without any python coding.

Run mirdeep using a configuration file

mirdeep2 -c <mdp.conf> -r

Config file format is as follows:

[base]
input = /path/to/input files #(fasta or fastq)
adapter = 
filetype = fastq
bowtieindex = /path/to/bowtie_index
refgenome = /path/to/ref_genome.fa
species = bta 
mature = 
hairpin = 
other = hsa
randfold = 1
mirbase = /path/to/mirbase_file
overwrite = 0

Usage in Python:

from smallrnaseq import mirdeep2

#run mirdeep2 on multiple fastq files, stored in path
mirdeep2.run_multiple(path, fasta=False)

#get mirdeep results as a Pandas DataFrame
df = mirdeep2.get_results(path)

#filter the mirnas according to various parameters
df = mirdeep2.filter_expr_results(score=0, freq=30, meanreads=500)

Output

Running the command line program produces the usual mirdeep2 output. This can then be analysed further using this command:

mirdeep2 -a <results_folder>

This produces files called known_mirdeep.csv and novel_mirdeep.csv along with various plots.

When using Python the command mirdeep2.get_results(path) produces a pandas DataFrame of the following form:

                read_count      precursor       total        s01       s02        s03        s04  \
#miRNA                                                                                             
bta-miR-486     78263227.0    bta-mir-486  78263227.0  3701115.0  629648.0  4241904.0  6742809.0   
bta-miR-92a      2997019.0  bta-mir-92a-1   2997019.0   148076.0   28384.0   196887.0   214518.0   
bta-miR-191      1005259.0    bta-mir-191   1005259.0    32274.0    8205.0    63262.0    44913.0   
bta-miR-25        939122.0     bta-mir-25    939122.0    35888.0    8639.0    47370.0    61931.0   
bta-miR-142-5p    497928.0    bta-mir-142    497928.0     7098.0    7684.0    14487.0    60216.0   

                      s05        s06        s07      ...        UCSC browser  NCBI blastn  \
#miRNA                                               ...                                    
bta-miR-486     3829302.0  2646240.0  7186343.0      ...                   -            -   
bta-miR-92a      129283.0    80550.0   191009.0      ...                   -            -   
bta-miR-191       40074.0    17177.0    45155.0      ...                   -            -   
bta-miR-25        55032.0    30991.0    47742.0      ...                   -            -   
bta-miR-142-5p    16127.0    11496.0    43682.0      ...                   -            -   

                consensus mature sequence  consensus star sequence  \
#miRNA                                                               
bta-miR-486         uccuguacugagcugccccga    cgggucagcucaguaccgggc   
bta-miR-92a        uauugcacuugucccggccugu  agguugggaucgguugcaaugcu   
bta-miR-191       caacggaaucccaaaagcagcug    cugcgcuuggauuucguuccc   
bta-miR-25         cauugcacuugucucggucuga  aggcggagacuugggcaauugcu   
bta-miR-142-5p       cccauaaaguagaaagcacu   aguguuuccuacuuuauggaug   

                                                    consensus precursor sequence  \
#miRNA                                                                             
bta-miR-486      uccuguacugagcugccccgaggcccuucgcugugcccagcucgggucagcucaguaccgggc   
bta-miR-92a          agguugggaucgguugcaaugcuguguuucuguaugguauugcacuugucccggccugu   
bta-miR-191     caacggaaucccaaaagcagcuguugucuccagagcauuccagcugcgcuuggauuucguuccc   
bta-miR-25          aggcggagacuugggcaauugcuggacgcugccccgggcauugcacuugucucggucuga   
bta-miR-142-5p   cccauaaaguagaaagcacuacuaacagcacuggaggguguaguguuuccuacuuuauggaug   

                   precursor coordinate  novel  chr     seed      mean_norm  
#miRNA                                                                       
bta-miR-486     27:36261847..36261910:-  False   27  ccuguac  848061.757500  
bta-miR-92a     12:66227265..66227324:+  False   12  auugcac   32037.220000  
bta-miR-191     22:51543484..51543548:+  False   22  aacggaa    9999.677500  
bta-miR-25      25:36892462..36892522:+  False   25  auugcac    9859.833333  
bta-miR-142-5p    19:9527315..9527378:-  False   19  ccauaaa    5490.591667 

Links

1. miRDeep2